Difference between revisions of "Part:BBa K2259014"
Line 4: Line 4:
 
<partinfo>BBa_K2259014 short</partinfo>
 
<partinfo>BBa_K2259014 short</partinfo>
  
−
RNAII acts as a pre-primer and begins the synthesis of plasmid DNA leader strand. The transcript folds into a secondary structure which stabilises the interaction between the nascent RNA and the origin's DNA. This hybrid is attacked by RNase H, which cleaves the RNA strand, exposing a 3' hydroxyl group. This allows the extension of the leading strand by DNA Polymerase I. Lagging strand synthesis is later initiated by a primase encoded by the host cell.
+
First of the two riboregulatory sequences implemented into SynORI selection system, designed by Green, Alexander A. et al. The sequence acts as an on/off switch to regulate the translation of the downstream gene. It is activated by a trigger RNA [[part:BBa_K2259016]]. In the absence of RNA trigger transcript, toehold locks the translation of a downstream gene. By introducing trigger RNA transcript, the translation is free to initiate and produce the gene of interest.
 +
 
 +
The Toehold linker sequence has an additional T nucleotide at the 3’ end to stay in frame with the downstream gene as it starts the translation which propagates into downstream biobrick.  
 +
 
 +
It is important to note, that it is advised to use this part with downstream coding sequences that has a prefix sequence 5' GAATTCGCGGCCGCTTCTAGAG '3 (used with non-coding sequences), as the standard prefix (and its scar) for protein coding genes contains a stop codon.
 +
 
  
  
Line 23: Line 28:
 
=Introduction=
 
=Introduction=
 
==Biology==
 
==Biology==
−
===ColE1 plasmid replication overview===
+
===The overview of Toehold riboregulators===
  
−
[[Image:Cole1 horizontal cropped.png|center|500px|thumb|<b>Figure 1. </b> Main principles of ColE1 plasmid family replication. (Citation needed)]]
+
[[Image:Toehold.png|center|500px|thumb|<b>Figure 1. </b> Main principle mechanism of Toehold Switch by Green, Alexander A. et al ]]
−
<b>ColE1-type plasmid replication begins with synthesis of plasmid encoded RNA II</b> (also called primer transcript) by RNA polymerase which initiates transcription at a site 555bp upstream of origin of replication. The RNA transcript forms a RNA - DNA hybrid with template DNA near the origin of replication. Hybridized RNA is then cleaved at the replication origin by RNAse H and serves as a primer for DNA synthesis by DNA polymerase I (Figure 1. A).
+
Toehold is a short RNA sequence that contains a ribosome binding site and a start codon followed by 9 amino acid linker. Importantly, it forms a stable secondary RNA hairpin structure that, in addition to locking the start codon in the stem loop, sequesters the ribosome binding site in a bulge loop. As a consequence of stable secondary structure, the ribosome cannot bind and initiate the translation of a downstream gene. The linker codes for low-molecular-weight amino acids added to the N terminus of the gene of interest. This sequence increases the orthogonality of the toehold switches as it is important in forming the base of the stem loop and locks the start codon in it. The trigger RNA binds the 5’ end of the toehold and initiates strand displacement by linear-linear interaction. As a result of that, the ribosome binding site and the start codon are accessible for ribosome binding and translation initiation. Since the trigger RNA binds the 5’ end of the toehold sequence, the nucleotide composition of it is an important factor that adds to the degree of different toehold systems cross interaction. By employing a specific linker sequence, the number of unique triggers with minimal cross interaction increases.  
  
−
<b>Initiation of replication can be inhibited by plasmid encoded small RNA, called RNA I </b>. Synthesis of RNA I starts 445 bp upstream of the replication origin and proceeds in the direction opposite to that of RNA II synthesis, and terminates near the RNA II transcription initiation site. <b>RNA I binds to RNA II</b> and thereby prevents formation of a secondary structure of RNA II that is necessary for hybridization of RNA II to the template DNA (Figure 1. B).
 
  
 
For RNA I to inhibit primer formation, it must bind before the nascent RNA II transcript extends to the replication origin. Consequently, the concentration of RNA I and the rate of binding of RNA I to RNA II is critical for regulation of primer formation and thus for plasmid replication.
 
For RNA I to inhibit primer formation, it must bind before the nascent RNA II transcript extends to the replication origin. Consequently, the concentration of RNA I and the rate of binding of RNA I to RNA II is critical for regulation of primer formation and thus for plasmid replication.
−
 
−
Interaction between RNA I and RNA II can be amplified by Rop protein, see [[part:BBa_K2259010]].
 
−
 
−
Rop dimer is a bundle of four tightly packed alpha helices that are held by hydrophobic interactions (Fig. 2).
 
  
 
==Usage with SynORI (Framework for multi-plasmid systems)==
 
==Usage with SynORI (Framework for multi-plasmid systems)==
Line 42: Line 42:
 
SynORI is a framework for multi-plasmid systems created by ''Vilnius-Lithuania 2017'' which enables quick and easy workflow with multiple plasmids, while also allowing to freely pick and modulate copy number for every unique plasmid group! Read more about [http://2017.igem.org/Team:Vilnius-Lithuania SynORI here]!
 
SynORI is a framework for multi-plasmid systems created by ''Vilnius-Lithuania 2017'' which enables quick and easy workflow with multiple plasmids, while also allowing to freely pick and modulate copy number for every unique plasmid group! Read more about [http://2017.igem.org/Team:Vilnius-Lithuania SynORI here]!
  
−
===Regulative RNA II molecule in SynORI===
+
===Toehold riboregulators in SynORI===
−
RNA II gene is foundational and central biobrick of SynORI system, and by far the only one that is mandatory for framework to run.  
+
Toehold switches together with their corresponding RNA triggers and split antibiotic genes completes the dynamic SynORI selection system. The switches lock the translation of downstream split antibiotic genes and form an AND type gate genetic circuit which functions to stably maintain multiple plasmids in the SynORI collection.
−
The two main functions of RNA II is as follows:
+
Toehold switches are used for these multi plasmid systems:
−
# Initiating plasmid replication
+
#• 3 plasmids
−
# Interacting with RNA I of specific plasmid group [[#Specific RNA II versions in multi-plasmid systems|(See below)]]
+
(Layout: One toehold ([[part:BBa_K2259014]] or [[part:BBa_K2259015]]), One trigger RNA ([[part:BBa_K2259016]] or [[part:BBa_K2259017]]) and split antibiotic genes ([[part:BBa_K2259018]] and [[part:BBa_K2259019]]).
 +
#• 4 plasmids
 +
(Layout: Two toeholds ([[part:BBa_K2259014]] and [[part:BBa_K2259015]]), Two trigger RNAs ([[part:BBa_K2259016]] and [[part:BBa_K2259017]]) and split antibiotic genes ([[part:BBa_K2259018]] and [[part:BBa_K2259019]]).
 +
#• 5 plasmids
 +
(Layout: Modified phage control system [[part:BBa_K2259044]], Two toeholds ([[part:BBa_K2259014]] and [[part:BBa_K2259015]]), Two repressed trigger RNAs ([[part:BBa_K2259042]] and [[part:BBa_K2259043]]) and split antibiotic genes ([[part:BBa_K2259018]] and [[part:BBa_K2259019]]).
  
 +
===Two groups of Toeholds===
 +
SynORI collection introduces two Toehold sequences termed Toehold 1 and Toehold 2 which only interact with its corresponding Trigger RNA, termed Trigger 1 and Trigger 2 and display no cross interaction.
  
−
===Specific RNA II versions in multi-plasmid systems===
 
  
−
RNA II interacts with inhibitory RNA I with three secondary RNA stem loops. In order to create plasmid groups with independent copy number control, one group's RNA II molecule must interact only with the same group's RNA I molecule.
 
  
−
<b>For example</b> if there are two plasmid groups in a cell - A and B - RNA II of A group
 
−
would only interact with RNA I A, and not RNA I B.
 
  
−
[[Image:RnainteractionIII.png|center|500px|thumb|<b>Figure 1. </b> RNA I AND II group interaction example]]
+
==References==
 +
Toehold Switches: De-Novo-Designed Regulators of Gene Expression
  
−
===Origin of RNA II biobrick===
+
Green, Alexander A. et al.
−
In order to flexibly control the synthesis of RNA I (Why RNA I ? <link to RNA I biobrick>), the RNA I gene first needed to be inactivated in ColE1 origin of replication. That, however, was not a trivial task, as ColE1 ORI is an antisense system, which means that by changing RNA I promoter sequence, one also changes the RNA II secondary structure, which is crucial for plasmid replication initiation (Find out more about how team Vilnius-Lithuania solved this problem by pressing this link! <LINK REQUIRED>). This is the main reason why, in SynORI framework, the wildtype ColE1 ORI is split into two different parts - <b> RNR I and RNA II </b>.
+
Cell , Volume 159 , Issue 4 , 925 - 939
−
 
+
−
<Picture of how RNA I promoter mutations might destroy RNA II secondary structure.>
+
−
 
+
−
 
+
−
=Characterization of RNA II (Vilnius-Lithuania 2017)=
+
−
==Constitutive Rop protein effect on plasmid copy number==
+
−
To be updated!
+
−
 
+
−
==References==
+
−
<references />
+

Revision as of 12:46, 31 October 2017


Toehold 1 of SynORI selection system

First of the two riboregulatory sequences implemented into SynORI selection system, designed by Green, Alexander A. et al. The sequence acts as an on/off switch to regulate the translation of the downstream gene. It is activated by a trigger RNA part:BBa_K2259016. In the absence of RNA trigger transcript, toehold locks the translation of a downstream gene. By introducing trigger RNA transcript, the translation is free to initiate and produce the gene of interest.

The Toehold linker sequence has an additional T nucleotide at the 3’ end to stay in frame with the downstream gene as it starts the translation which propagates into downstream biobrick.

It is important to note, that it is advised to use this part with downstream coding sequences that has a prefix sequence 5' GAATTCGCGGCCGCTTCTAGAG '3 (used with non-coding sequences), as the standard prefix (and its scar) for protein coding genes contains a stop codon.



Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]



Introduction

Biology

The overview of Toehold riboregulators

Figure 1. Main principle mechanism of Toehold Switch by Green, Alexander A. et al

Toehold is a short RNA sequence that contains a ribosome binding site and a start codon followed by 9 amino acid linker. Importantly, it forms a stable secondary RNA hairpin structure that, in addition to locking the start codon in the stem loop, sequesters the ribosome binding site in a bulge loop. As a consequence of stable secondary structure, the ribosome cannot bind and initiate the translation of a downstream gene. The linker codes for low-molecular-weight amino acids added to the N terminus of the gene of interest. This sequence increases the orthogonality of the toehold switches as it is important in forming the base of the stem loop and locks the start codon in it. The trigger RNA binds the 5’ end of the toehold and initiates strand displacement by linear-linear interaction. As a result of that, the ribosome binding site and the start codon are accessible for ribosome binding and translation initiation. Since the trigger RNA binds the 5’ end of the toehold sequence, the nucleotide composition of it is an important factor that adds to the degree of different toehold systems cross interaction. By employing a specific linker sequence, the number of unique triggers with minimal cross interaction increases.


For RNA I to inhibit primer formation, it must bind before the nascent RNA II transcript extends to the replication origin. Consequently, the concentration of RNA I and the rate of binding of RNA I to RNA II is critical for regulation of primer formation and thus for plasmid replication.

Usage with SynORI (Framework for multi-plasmid systems)

About SynORI

Aboutsynoritry1.png

SynORI is a framework for multi-plasmid systems created by Vilnius-Lithuania 2017 which enables quick and easy workflow with multiple plasmids, while also allowing to freely pick and modulate copy number for every unique plasmid group! Read more about [http://2017.igem.org/Team:Vilnius-Lithuania SynORI here]!

Toehold riboregulators in SynORI

Toehold switches together with their corresponding RNA triggers and split antibiotic genes completes the dynamic SynORI selection system. The switches lock the translation of downstream split antibiotic genes and form an AND type gate genetic circuit which functions to stably maintain multiple plasmids in the SynORI collection. Toehold switches are used for these multi plasmid systems:

  1. • 3 plasmids

(Layout: One toehold (part:BBa_K2259014 or part:BBa_K2259015), One trigger RNA (part:BBa_K2259016 or part:BBa_K2259017) and split antibiotic genes (part:BBa_K2259018 and part:BBa_K2259019).

  1. • 4 plasmids

(Layout: Two toeholds (part:BBa_K2259014 and part:BBa_K2259015), Two trigger RNAs (part:BBa_K2259016 and part:BBa_K2259017) and split antibiotic genes (part:BBa_K2259018 and part:BBa_K2259019).

  1. • 5 plasmids

(Layout: Modified phage control system part:BBa_K2259044, Two toeholds (part:BBa_K2259014 and part:BBa_K2259015), Two repressed trigger RNAs (part:BBa_K2259042 and part:BBa_K2259043) and split antibiotic genes (part:BBa_K2259018 and part:BBa_K2259019).

Two groups of Toeholds

SynORI collection introduces two Toehold sequences termed Toehold 1 and Toehold 2 which only interact with its corresponding Trigger RNA, termed Trigger 1 and Trigger 2 and display no cross interaction.



References

Toehold Switches: De-Novo-Designed Regulators of Gene Expression

Green, Alexander A. et al. Cell , Volume 159 , Issue 4 , 925 - 939