Difference between revisions of "Part:BBa K2382004:Design"
Herlohuang (Talk | contribs) (→Design Notes) |
Herlohuang (Talk | contribs) (→Design Notes) |
||
Line 7: | Line 7: | ||
===Design Notes=== | ===Design Notes=== | ||
− | Thioredoxin could help the protein folding correctly, and make the fusion proteins in soluble form that are biologically active.And we remove the stop coden of Thioredoxin | + | Thioredoxin could help the protein folding correctly, and make the fusion proteins in soluble form that are biologically active. |
− | (NC_000913.3) so that it can be used in fusion protein designing. | + | |
− | We Insert linker between our two proteins: thioredoxine and | + | And we remove the stop coden of Thioredoxin(NC_000913.3) so that it can be used in fusion protein designing. |
− | The purpose is to separate these two proteins | + | |
+ | |||
+ | We Insert linker between our two proteins: thioredoxine and FGD. | ||
+ | The purpose to do so is to separate these two proteins. | ||
+ | |||
The sequence of Linker contain the polylinker ,and that is: GGTACCCGGGGATCCCTCGAGGGTGGT, | The sequence of Linker contain the polylinker ,and that is: GGTACCCGGGGATCCCTCGAGGGTGGT, | ||
There are four restriction site in it: | There are four restriction site in it: | ||
+ | |||
Kpn1:GGT’ACC | Kpn1:GGT’ACC | ||
+ | |||
Sma1: CCC’GGG | Sma1: CCC’GGG | ||
+ | |||
BamH1:GGA’TCC | BamH1:GGA’TCC | ||
+ | |||
Xho1:C’TCGAG | Xho1:C’TCGAG | ||
− | + | ||
+ | Two glycine are added at the end of the sequence, and it allows the protein behind linker can be reversed, reducing the probability of protein folding error. | ||
===Source=== | ===Source=== | ||
We have it synthesized by AllBio Science Incorporated. | We have it synthesized by AllBio Science Incorporated. |
Revision as of 02:16, 30 October 2017
Thioredoxin with polylinker
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 367
Illegal XhoI site found at 373 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
Thioredoxin could help the protein folding correctly, and make the fusion proteins in soluble form that are biologically active.
And we remove the stop coden of Thioredoxin(NC_000913.3) so that it can be used in fusion protein designing.
We Insert linker between our two proteins: thioredoxine and FGD.
The purpose to do so is to separate these two proteins.
The sequence of Linker contain the polylinker ,and that is: GGTACCCGGGGATCCCTCGAGGGTGGT, There are four restriction site in it:
Kpn1:GGT’ACC
Sma1: CCC’GGG
BamH1:GGA’TCC
Xho1:C’TCGAG
Two glycine are added at the end of the sequence, and it allows the protein behind linker can be reversed, reducing the probability of protein folding error.
Source
We have it synthesized by AllBio Science Incorporated.