Difference between revisions of "Part:BBa K2323002"
Line 16: | Line 16: | ||
− | + | ===Cloning, expression and Purification=== | |
The His-tag was added to pSB1C3-BBa-K1319008 by PCR with overhang primers p-TEV-His-fwd and p-TEV-His-rev. | The His-tag was added to pSB1C3-BBa-K1319008 by PCR with overhang primers p-TEV-His-fwd and p-TEV-His-rev. | ||
{| | {| | ||
Line 51: | Line 51: | ||
[[Image:BBa_K2323002_TEV_Cleavage.png | thumb | center | 600px | TEV-protease activity assay]] | [[Image:BBa_K2323002_TEV_Cleavage.png | thumb | center | 600px | TEV-protease activity assay]] | ||
− | |||
− | |||
Revision as of 19:50, 29 October 2017
TEV protease with N-terminal 6x His-Tag under the control of the pT7 promoter
Introduction
TEV protease is a highly specific cysteine protease from the Tobacco Etch Virus. An improvement over BBa_K1319008, the protease can be expressed in strains with T7-polymerase and then purified with the help of the His-TAg for synthetic in-vitro circuits.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 71
Illegal AgeI site found at 803 - 1000COMPATIBLE WITH RFC[1000]
Usage and Biology
The Tobacco Etch Virus (TEV) protease is a cysteine protease with high specificity towards its target sequence. Along with other two proteins in the Tobacco Etch Virus, it has the function to cleave the polyprotein that is produced after translating the whole (+)-stran RNA genome of the virus. In addition, the natural TEV protease contains its own target sequence and thus cleaves itself, reducing its activity over time. For scientists the TEV protease is a molecular tool to cleave of all sorts of protein tags precisely due to its sequence specificity. It recognises the amino acid sequence Glu-Asn-Leu-Tyr-Gln-Ser and cleaves then between glutamic acid and serine. This target sequence is uncommon in natural proteins, allowing the in-vivo expression and use of TEV protease without a toxic side-effect caused by unwanted cleavage of host proteins. To avoid the autolysis, TEV protease is usually used with a single S219V point mutation to make the cleavage site unrecognisable for the protein.
Cloning, expression and Purification
The His-tag was added to pSB1C3-BBa-K1319008 by PCR with overhang primers p-TEV-His-fwd and p-TEV-His-rev.
Name | 5'-3' primers sequences |
---|---|
p-TEV-His-fwd | catcatcaccatcaccacgccggcggcgaaagc |
p-TEV-His-rev | catctagtatttctcctctttctctagtatctccc |
After PCR we ligated the plasmid using the T4 ligase. This sample was then transformed in E. coli DH5α for plasmid storage and E. coli BL21star for protein expression. We expressed the TEV protease in 2xYT medium and purified it via affinity and size exclusion chromatography.
For an activity test, we incubated 30 µg His-MBP-Cas13a-Lsh as substrate with 1 µg of our TEV protease. We inactivated the cleavage reaction by adding 1x SDS-loading buffer. We analyzed the reaction with a SDS-PAGE and loaded samples, which were incubated 0, 1, 2, 3, 4 ,5 and overnight. The gel shows that nearly all our substrate is already cleaved after 1 h into His-MBP and Cas13a-Lsh.