Difference between revisions of "Part:BBa K2382004:Design"
Herlohuang (Talk | contribs) |
Herlohuang (Talk | contribs) (→Design Notes) |
||
Line 7: | Line 7: | ||
===Design Notes=== | ===Design Notes=== | ||
− | + | Thioredoxin could help the protein folding correctly, and make the fusion proteins in soluble form that are biologically active.And we remove the stop coden of Thioredoxin | |
− | (NC_000913.3) so that it can be used in fusion protein designing. | + | (NC_000913.3) so that it can be used in fusion protein designing. |
− | + | We Insert linker between our two proteins: thioredoxine and MSMEG5998. | |
− | + | The purpose is to separate these two proteins | |
− | + | The sequence of Linker contain the polylinker ,and that is: GGTACCCGGGGATCCCTCGAGGGTGGT, | |
+ | There are four restriction site in it: | ||
+ | Kpn1:GGT’ACC | ||
+ | Sma1: CCC’GGG | ||
+ | BamH1:GGA’TCC | ||
+ | Xho1:C’TCGAG | ||
+ | The last of the sequence plus two glycine, and it allow the protein behind linker can be reversed, reducing the probability of protein folding error. | ||
===Source=== | ===Source=== |
Revision as of 12:13, 29 October 2017
Thioredoxin with polylinker
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 367
Illegal XhoI site found at 373 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
Thioredoxin could help the protein folding correctly, and make the fusion proteins in soluble form that are biologically active.And we remove the stop coden of Thioredoxin (NC_000913.3) so that it can be used in fusion protein designing. We Insert linker between our two proteins: thioredoxine and MSMEG5998. The purpose is to separate these two proteins The sequence of Linker contain the polylinker ,and that is: GGTACCCGGGGATCCCTCGAGGGTGGT, There are four restriction site in it: Kpn1:GGT’ACC Sma1: CCC’GGG BamH1:GGA’TCC Xho1:C’TCGAG The last of the sequence plus two glycine, and it allow the protein behind linker can be reversed, reducing the probability of protein folding error.
Source
Escherichia coli str. K-12 substr. MG1655 https://www.ncbi.nlm.nih.gov/nuccore/NC_000913.3