Difference between revisions of "Part:BBa K2382003:Design"
(→‎Design Notes)
Line 5: Line 5:
  
 
===Design Notes===
 
===Design Notes===
−
3Lorem ipsum dolor sit amet, consectetur adipiscing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris nisi ut aliquip ex ea commodo consequat. Duis aute irure dolor in reprehenderit in voluptate velit esse cillum dolore eu fugiat nulla pariatur. Excepteur sint occaecat cupidatat non proident, sunt in culpa qui officia deserunt mollit anim id est laborum.
+
We use the T7 promotor from Part:BBa_K525998(Group: iGEM11_Bielefeld-Germany  (2011-09-13))
−
 
+
>sequence (32 bp)
 +
taatacgactcactatagggaaagaggagaaa
 +
We add additional sequence on it. There are two function in our sequence follow the T7 promotor. One is lac operator, the other is RBS binding site.
  
 +
Lac operator could be bound with lac repressor. It could stop the transcription to prevent making protein. Genome of E.coli has the lacI gene. It could translate the repressor to inhibit protein produced. That is, we design the lac operator into our sequence to prevent the leak of expressing protein.
 +
RBS binding site could let the ribosome attach on the mRNA sequence to produce the enzyme.
 +
These sequence is derived from pET-29a(+) sequence. Because the original part has the restriction site”Xba1”in the sequence, and the sequence of this restriction site is” TCTAGA. “ We do the single mutation to convert TC”T”AGA to TC”C”AGA . Thus, the restriction site would not be recognized by restriction enzyme and cut off. That is, it is safe to use to compose the sequence for igem.
  
 
===Source===
 
===Source===

Revision as of 10:48, 29 October 2017

T7 promoter & Lac operator and RBS from PET-29a


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]

Design Notes

We use the T7 promotor from Part:BBa_K525998(Group: iGEM11_Bielefeld-Germany (2011-09-13)) >sequence (32 bp) taatacgactcactatagggaaagaggagaaa We add additional sequence on it. There are two function in our sequence follow the T7 promotor. One is lac operator, the other is RBS binding site.

Lac operator could be bound with lac repressor. It could stop the transcription to prevent making protein. Genome of E.coli has the lacI gene. It could translate the repressor to inhibit protein produced. That is, we design the lac operator into our sequence to prevent the leak of expressing protein. RBS binding site could let the ribosome attach on the mRNA sequence to produce the enzyme. These sequence is derived from pET-29a(+) sequence. Because the original part has the restriction site”Xba1”in the sequence, and the sequence of this restriction site is” TCTAGA. “ We do the single mutation to convert TC”T”AGA to TC”C”AGA . Thus, the restriction site would not be recognized by restriction enzyme and cut off. That is, it is safe to use to compose the sequence for igem.

Source

2Lorem ipsum dolor sit amet, consectetur adipiscing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris nisi ut aliquip ex ea commodo consequat. Duis aute irure dolor in reprehenderit in voluptate velit esse cillum dolore eu fugiat nulla pariatur. Excepteur sint occaecat cupidatat non proident, sunt in culpa qui officia deserunt mollit anim id est laborum.

References