Difference between revisions of "Part:BBa K2281001"

Line 15: Line 15:
 
HbOYE stands for Hevea brasiliensis Old Yellow Enzyme which is the reductase which bolsters the production of cireonellol from geraniol.
 
HbOYE stands for Hevea brasiliensis Old Yellow Enzyme which is the reductase which bolsters the production of cireonellol from geraniol.
  
(More information about HbOYE is on the page of part BBa_K2281006)
+
(More information about HbOYE is on the page of part BBa_K2281006 https://parts.igem.org/Part:BBa_K2281006#Introduction)
  
 
===F2A===
 
===F2A===
Line 25: Line 25:
  
 
SOURCE
 
SOURCE
The foot-and-mouth disease virus (FMDV) is the pathogen that causes foot-and-mouth disease.[1] It is a picornavirus, the prototypical member of the Aphthovirus genus. The disease, which causes vesicles (blisters) in the mouth and feet of bovids, suids, ovids, caprids and other cloven-hoofed animals is highly infectious and a major plague of animal farming.
+
  The foot-and-mouth disease virus (FMDV) is the pathogen that causes foot-and-mouth disease.[1] It is a picornavirus, the prototypical member of the Aphthovirus genus. The disease, which causes vesicles (blisters) in the mouth and feet of bovids, suids, ovids, caprids and other cloven-hoofed animals is highly infectious and a major plague of animal farming.
  
 
===PcGES===
 
===PcGES===
Line 43: Line 43:
 
             Pentapetalae; asterids; lamiids; Lamiales; Lamiaceae; Lamioideae;
 
             Pentapetalae; asterids; lamiids; Lamiales; Lamiaceae; Lamioideae;
 
             Pogostemoneae; Pogostemon.
 
             Pogostemoneae; Pogostemon.
 +
                                  https://static.igem.org/mediawiki/2017/c/c3/T--CIEI-BJ--part002--source.jpg
  
 
Patchouli (Pogostemon cablin) is a species of plant from the genus Pogostemon. It is a bushy herb of the mint family, with erect stems, reaching around 75 centimetres (2.5 ft) in height and bearing small, pale pink-white flowers. The plant is native to tropical regions of Asia, and is now extensively cultivated in China, Indonesia, Cambodia, Myanmar, India, Maldives, Malaysia, Mauritius, Seychelles, Madagascar, Taiwan, Philippines, Thailand, Vietnam, South America and the Caribbean.
 
Patchouli (Pogostemon cablin) is a species of plant from the genus Pogostemon. It is a bushy herb of the mint family, with erect stems, reaching around 75 centimetres (2.5 ft) in height and bearing small, pale pink-white flowers. The plant is native to tropical regions of Asia, and is now extensively cultivated in China, Indonesia, Cambodia, Myanmar, India, Maldives, Malaysia, Mauritius, Seychelles, Madagascar, Taiwan, Philippines, Thailand, Vietnam, South America and the Caribbean.
Line 74: Line 75:
  
 
REFERENCE  3
 
REFERENCE  3
AUTHORS  Mao, Jian Ping
+
  AUTHORS  Mao, Jian Ping
TITLE  Bridge PCR,An Easy Way for Concatemerizing DNA Tags
+
  TITLE  Bridge PCR,An Easy Way for Concatemerizing DNA Tags
JOURNAL  China Biotechnology (2009).
+
  JOURNAL  China Biotechnology (2009).
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here

Revision as of 07:53, 29 October 2017


-HbOYE-F2A-PcGES-

T--CIEI-BJ--part--001.jpg

HbOYE

LOCUS DQ004685

SIZE 1455 bp

DEFINITION Hevea brasiliensis 12-oxophytodienoate reductase (opr).

HbOYE stands for Hevea brasiliensis Old Yellow Enzyme which is the reductase which bolsters the production of cireonellol from geraniol.

(More information about HbOYE is on the page of part BBa_K2281006 https://parts.igem.org/Part:BBa_K2281006#Introduction)

F2A

F2A sequence: CAGCTGTTGAATTTTGACCTTCTTAAGCTTGCGGGAGACGTCGAGTCCAACCCTGGGCCC

2A, known as CHYSEL polypeptides, contains the peptide bond to grow the peptide chain which helps to link two genes. The presence of the conserved CHYSEL residues in the peptides (Donnelly et al., 1997; Ryan et al., 2002) contributes to form a torsion which causes the peptide chain to be released later (Ryan et al., 2002), and then the two genes can express in a cell separately.

SOURCE

 The foot-and-mouth disease virus (FMDV) is the pathogen that causes foot-and-mouth disease.[1] It is a picornavirus, the prototypical member of the Aphthovirus genus. The disease, which causes vesicles (blisters) in the mouth and feet of bovids, suids, ovids, caprids and other cloven-hoofed animals is highly infectious and a major plague of animal farming.

PcGES

LOCUS KF926075

SIZE 1734 bp

DEFINITION Pogostemon cablin geraniol synthase (GS1) mRNA, partial cds.

PcGES stands for Pogostemon cablin geraniol synthase (GS1) mRNA which is an enzyme which bolsters the production of geraniol. Through the MVA or DXP pathway, Geranyl Diphosphate (GPP) can be produced. Then PcGES helps convert GPP to geraniol.

SOURCE Pogostemon cablin (patchouli)

 ORGANISM  Pogostemon cablin
           Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
           Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae;
           Pentapetalae; asterids; lamiids; Lamiales; Lamiaceae; Lamioideae;
           Pogostemoneae; Pogostemon.
                                 T--CIEI-BJ--part002--source.jpg

Patchouli (Pogostemon cablin) is a species of plant from the genus Pogostemon. It is a bushy herb of the mint family, with erect stems, reaching around 75 centimetres (2.5 ft) in height and bearing small, pale pink-white flowers. The plant is native to tropical regions of Asia, and is now extensively cultivated in China, Indonesia, Cambodia, Myanmar, India, Maldives, Malaysia, Mauritius, Seychelles, Madagascar, Taiwan, Philippines, Thailand, Vietnam, South America and the Caribbean.

Experiments

In our experiments, due to the position of domain, we have to ligate F2A to the downstream of HbOYE by using bridge PCR. Then this integration is ligated to PcOYE to form a whole. The product is our part.

Information about bridge PCR: In MAST (mRNA accessible site tagging), the DNA tags from synthesized library were employed for identifying mRNA accessible sites. A large number of tags were amplified and subcloned for sequencing to verify mRNA binding profiles. A PCR was designed by using one primer which bridges over the tag terminal sequences. In PCR reaction DNA tag fragments were concatemerized by a bridge primer in reaction cycles.

Purpose for designing this part

The whole purpose of our project is to optimize the efficiency of producing citronellol, so as we combine GES and OYE with 2A, the productive efficiency will be achieved. As for this goal, this part is essential for our project. When functioning, since 2A functions as separating GES gene and OYE gene, which can be automatic removed by cell itself, two independent proteins can be synthesized properly throughout the process. Therefore, but only the final product will be same as before, but also the efficiency is improved.

References

REFERENCE 1 (bases 1 to 1734)

 AUTHORS   Ouyang,P., Zeng,S. and Mo,X.
 TITLE     Cloning and Expression Analysis patchouli geraniol synthase Clone
           and Expression Analysis of Geraniol Synthase Gene in Pogostemon
           cablin
 JOURNAL   Xibei Zhiwu Xuebao 36, 5 (2016)

REFERENCE 2 (bases 1 to 1734)

 AUTHORS   Ouyang,P. and Mo,X.
 TITLE     Direct Submission
 JOURNAL   Submitted (26-NOV-2013) Traditional Chinese Medicine, Guangdong
           Food and Grug Vocational College, Longdong North Road No. 321,
           Tianhe District, Guangzhou, Guangdong 510520, China


REFERENCE 3

 AUTHORS   Mao, Jian Ping
 TITLE   Bridge PCR,An Easy Way for Concatemerizing DNA Tags
 JOURNAL   China Biotechnology (2009).

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]