Difference between revisions of "Part:BBa K2333403"
Line 3: Line 3:
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K2333403 short</partinfo>
 
<partinfo>BBa_K2333403 short</partinfo>
 +
This part is designed to facilitate quick, easy and reproducible cloning of protein degradation tag (pdt) C, onto an arbitrary gene, regardless of cloning method. William and Mary iGEM 2017 used pdts as a method to control gene expression speed. Utilizing this part along with results and mathematical modeling from William and Mary should enable the tuning of gene expression speed for any arbitrary protein in a circuit, without having to perform a multistep re-cloning process.See [http://2017.igem.org/Team:William_and_Mary/Results William and Mary's 2017 project] for more details
  
−
This part is designed to easily facilitate appending the pdt#3 tag to the end of an arbitrary protein using Gibson assembly, without requiring multiple cloning steps. UNS pdt#3 DT contains a tail that can be degrade Mesoplasma florum’s Lon protease <b>Link mf-Lon here</b>, which is orthogonal to E. Coli’s own degradation machinery. As this part contains both a double stop codon and the B0015 double terminator, it can be added before the stop codons of an arbitrary protein, preventing a multistep assembly to incorporate double stop codons and a double terminator.
+
This part is one of a series of easy cloning pdt parts. Series range is from <partinfo>BBa_K2333401</partinfo> to <partinfo>Bba_K2333406</partinfo>
  
−
<b>UNS pdt#3b DT</b> is on the William and Mary iGEM standard backbone, which contains 40bp Universal Nucleotide Sequences (UNS) on the inside of the prefix/suffix as a standardized flanking region to facilitate oligo-based cloning methods like PCR and gibson assembly. See Torella, J. P., Boehm, C. R., Lienert, F., Chen, J. H., Way, J. C., & Silver, P. A. (2013).
 
  
−
This part belongs to a series comprising 6 parts with pdt tags of different strengths BBa_ K2333401-K2333406. Of this series, the pdt in this part has a very moderate and consistent degradation rate. It's also the first tag that we assembled and tested to be successful. See characterization from William and Mary 2017, and also Collins et al. 2014 "Tunable Protein Degradation in Bacteria" for background informaiton.
 
−
 
−
This design significantly increases the accessibility of the mf- Lon tags, which can be easily added to the end of any arbitrary protein on either William and Mary's UNS backbone system or a standard Biobrick vector. Using a reverse primer with a pdt overhang to the end of a given protein, any team can easily create and amplify their own linear fragment with parts BBa_ K2333401-K2333406 to append a pdt tag onto a protein in a given circuit without changing other underlying architecture.
 
  
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here
 
===Usage and Biology===
 
===Usage and Biology===
 +
Protein degradation tag C is the third strongest of the 6 protein degradation tags that William and Mary 2017 characterized, and is associated with the E. Coli orthogonal protease mf-Lon (<partinfo>Bba_K2333011</partinfo>). While any mf-Lon generating part can be used alongside this tag to increase degradation rate/speed of a given protein of interest, the majority of William and Mary 2017's characterization was done using <partinfo>BBa_K2333434</partinfo>, which is a LacI regulated (IPTG inducible) mf-Lon. In cases where LacI cannot be used, the leakier Arabinose inducible mf-Lon <partinfo>Bba_K2333435</partinfo> can be used instead. (Note, it is recommended that these parts be used on a low copy backbone such as <partinfo>pSB3K3</partinfo>)
  
−
<!-- -->
+
This part contains pdt C, a double stop codon and <partinfo>Bba_B0015</partinfo> (double terminator) in the William and Mary iGEM Universal Nucleotide Sequences (UNS) format. This enables easy cloning with Gibson Assembly, as UNS primers are designed for easy PCRs and high yield Gibson Assembly. See Torella, et. al (2013). On the interior of each UNS are BsaI cut sites, which enables Golden Gate Assembly as an alternative to Gibson Assembly. For groups that want to use restriction enzyme cloning, or a different Golden Gate enzyme/overhang sequence, we recommend that they PCR using the primers below, and add on up to 30 basepairs of overhang.
 +
 
 +
Since this part contains both a double stop codon and a double terminator, to tag an arbitrary protein all that is required is to append this part without UNS2 to the end of your protein of choice. (Note, that the double stop codons of your protein should be removed, as this will prevent translation of the tag.)
 +
 
 +
===Primers===
 +
The primers below should be useful for cloning purposes. They each are short enough that 20+ basepairs of overhang can be added on, have annealing temperatures in Q5 greater than 60C, and have no significant homo-dimers, hairpins or hetero-dimers. UNS2 F and UNS3 R can be used for sequencing, or amplification to move parts to a new plasmid backbone. Since all of the protein degradation tags have the same first 33 base pairs, the Protein Degradation Primer can be used for any of the pdts in this part series. While these parts should be useful for any group using Gibson Cloning (either in or not in the W&M UNS backbone), they can also be used to add any arbitrary restriction site as well. Using the pdt F and B0015 R primers with restriction site overhangs added on should work robustly, as W&M 2017's used variants of this method to clone most of their tagged reporters. See [http://2017.igem.org/Team:William_and_Mary/Parts here] for a complete list.
 +
 
 +
 
 +
<html>
 +
<head>
 +
<style>
 +
table {
 +
width:80%;
 +
}
 +
 
 +
table, th, td {
 +
border-collapse: collapse;
 +
}
 +
 
 +
 
 +
th, td {
 +
padding: 12px;
 +
}
 +
</style>
 +
<table>
 +
<tr>
 +
<th style='background-color: #BEB9C7;column-width: 200px;'>Primer Name</th>
 +
<th style='background-color: #BEB9C7;column-width: 150px;'>Sequence</th>
 +
</tr>
 +
<tr>
 +
<td style='background-color: #ECE7F2;column-width: 200px;'><b>Protein Degradation Primer, Foward:</b></td>
 +
<td style='background-color: #ECE7F2;column-width: 150px;'>GCTGCTAACAAAAACGAAGAAAACAC
 +
</td>
 +
</tr>
 +
<tr>
 +
<td style='background-color: #DED9E5;column-width: 200px;'><b>UNS2 Primer, Forward:</b></td>
 +
<td style='background-color: #DED9E5;column-width: 150px;'>GCTGGGAGTTCGTAGACG</td>
 +
</tr>
 +
<tr>
 +
<td style='background-color: #ECE7F2;column-width: 200px;'><b>UNS3 Primer, Reverse:</b></td>
 +
<td style='background-color: #ECE7F2;column-width: 150px;'>CGACCTTGATGTTTCCAGTG
 +
</td>
 +
</tr>
 +
<tr>
 +
<td style='background-color: #DED9E5;column-width: 200px;'><b>End B0015 Primer, Reverse:</b></td>
 +
<td style='background-color: #DED9E5;column-width: 150px;'>tataaacgcagaaaggccca</td>
 +
</tr>
 +
<tr>
 +
<td style='background-color: #ECE7F2;column-width: 200px;'><b>Double stop + B0015 beginning, Forward:</b></td>
 +
<td style='background-color: #ECE7F2;column-width: 150px;'>TAATAAccaggcatcaaataaaacg</td>
 +
</tr>
 +
</table>
 +
</html>
 +
 
 +
 
 +
===Characterization===
 +
W&M 2017 characterized this tag's degradation rate and speed change effects as part of their iGEM project. The graphs below show this data along with the data from the other tags in this series
 +
Graph 1
 +
Graph 2
 +
 
 +
 
 +
<!-- --
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
 
<partinfo>BBa_K2333403 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K2333403 SequenceAndFeatures</partinfo>
  
 +
===References===
 +
[1] Torella JP, Boehm CR, Lienert F, Chen J-H, Way JC, Silver PA. Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly. Nucleic Acids Research. 2013;42(1):681–689.
 +
 +
[2] Cameron DE, Collins JJ. Tunable protein degradation in bacteria. Nature Biotechnology. 2014;32(12):1276–1281.
  
−
<!-- Uncomment this to enable Functional Parameter display
 
 
===Functional Parameters===
 
===Functional Parameters===
−
<partinfo>BBa_K2333403 parameters</partinfo>
+
<partinfo>BBa_K2333401 parameters</partinfo>
 
<!-- -->
 
<!-- -->

Revision as of 22:07, 28 October 2017


Cloning ready protein degradation tag C (medium-strong) with double terminator This part is designed to facilitate quick, easy and reproducible cloning of protein degradation tag (pdt) C, onto an arbitrary gene, regardless of cloning method. William and Mary iGEM 2017 used pdts as a method to control gene expression speed. Utilizing this part along with results and mathematical modeling from William and Mary should enable the tuning of gene expression speed for any arbitrary protein in a circuit, without having to perform a multistep re-cloning process.See [http://2017.igem.org/Team:William_and_Mary/Results William and Mary's 2017 project] for more details

This part is one of a series of easy cloning pdt parts. Series range is from BBa_K2333401 to BBa_K2333406