Difference between revisions of "Part:BBa K1641011"

 
 
(One intermediate revision by one other user not shown)
Line 1: Line 1:
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K1641011 short</partinfo>
 
<partinfo>BBa_K1641011 short</partinfo>
Line 5: Line 4:
 
This is the recognition site of Cre-like recombinase Vika, that is "AATAGGTCTGAGAACGCCCATTCTCAGACGTATT". This recognition site is not homologous with LoxP and hence will not cross-react with Cre or other common recombinases.  
 
This is the recognition site of Cre-like recombinase Vika, that is "AATAGGTCTGAGAACGCCCATTCTCAGACGTATT". This recognition site is not homologous with LoxP and hence will not cross-react with Cre or other common recombinases.  
  
Note: The brick sequence starts directly after the XbaI of prefix and ends before SpeI of the Suffix, without the useless bases (G and T respectively) added before and after brick sequence. This deletion do not interfere the usage of the brick.
+
Note: The brick sequence starts directly after the XbaI of prefix and ends before SpeI of the Suffix, without the useless bases (G and T respectively) added before and after brick sequence. The scar will be "ACTAGA" safely without cutting activity and start code. with This deletion do not interfere the usage of the brick.
  
 +
A twin page with data on orthogonality and recombination efficiency of this part can be found here <partinfo>BBa_K2406001</partinfo>
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here
 
===Usage and Biology===
 
===Usage and Biology===

Latest revision as of 21:52, 28 October 2017

Vox, recognition site of recombinase Vika

This is the recognition site of Cre-like recombinase Vika, that is "AATAGGTCTGAGAACGCCCATTCTCAGACGTATT". This recognition site is not homologous with LoxP and hence will not cross-react with Cre or other common recombinases.

Note: The brick sequence starts directly after the XbaI of prefix and ends before SpeI of the Suffix, without the useless bases (G and T respectively) added before and after brick sequence. The scar will be "ACTAGA" safely without cutting activity and start code. with This deletion do not interfere the usage of the brick.

A twin page with data on orthogonality and recombination efficiency of this part can be found here BBa_K2406001 Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]