Difference between revisions of "Part:BBa K2340000"
Line 5: | Line 5: | ||
− | |||
− | |||
− | |||
− | |||
− | |||
<!-- --> | <!-- --> | ||
− | <span class='h3bb'>Sequence and Features</span> | + | <span class='h3bb'><font size="+1"><b> Sequence and Features</b></font></span> |
<partinfo>BBa_K2340000 SequenceAndFeatures</partinfo> | <partinfo>BBa_K2340000 SequenceAndFeatures</partinfo> | ||
+ | |||
+ | |||
+ | <b><font size="+1"> Usage and Biology </font></b> | ||
+ | |||
+ | 'dead' CAS13a with a double HEPN nuclease 1 and 2 inactive mutation, linked to a green fluorescent protein (wtGFP) via a linker sequence (ggctcctccggc). On both ends of the construct there are nuclear localization sequences (NLS; cccaagaaaaaacgcaaggtg) that will reduce background noise when expressed and used in mammalian cell lines. | ||
+ | |||
+ | |||
Revision as of 16:32, 28 October 2017
dCAS13a linked to GFP with NLS
Sequence and Features
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 1112
Illegal BglII site found at 2048
Illegal BglII site found at 2312
Illegal BglII site found at 2816
Illegal BglII site found at 3302
Illegal BglII site found at 3410
Illegal BglII site found at 3740 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 662
Illegal SapI.rc site found at 3421
Usage and Biology
'dead' CAS13a with a double HEPN nuclease 1 and 2 inactive mutation, linked to a green fluorescent protein (wtGFP) via a linker sequence (ggctcctccggc). On both ends of the construct there are nuclear localization sequences (NLS; cccaagaaaaaacgcaaggtg) that will reduce background noise when expressed and used in mammalian cell lines.