Difference between revisions of "Part:BBa K2407303"

Latest revision as of 14:53, 28 October 2017

β-carotene gene

A composite part of three key genes to produce β-carotene which can be expressed in Saccharomyces Cerevisiae.

Introduction

After reviewing the literature, we understand that carotene can be overexpressed in Saccharomyces cerevisiae. Furthermore, carotenoid production levels were higher in strains containing integrated carotenogenic genes. Overexpression of crtYB and crtI from X. dendrorhous was sufficient to enable carotenoid production. crtYB, crtI, and crtE can complete the expression of β-carotene, and the cell is orange.

Components of the Mating switcher

To characterize our Mating Switcher, we built a gene route to switch the expression from RFP to β-carotene. In this route, we combined RFP with TEF-1 promoter. To prevent leaky expression, we choose two kinds of terminators——ADH1 and Ura3‘s. So β-carotene’s expression is controlled by promoter-vox-RFP-Terminators-vox structure. Before the mating-type switch, our yeast presents reddish color due to RFP’s expression. After the mating switcher, with the deletion of RFP and terminators flanked by vox locus, β-carotene expresses and the strains take on an orange color. In Saccharomyces cerevisiae, these two colors are easy to distinguish. In this way, we can easily visualize the function of our switcher, as well as measure its efficiency and error rate.

This part was amplified by using the primers indicated by René Verwaal (2007), Some of those primers are:

• crtYB-F CGC GGATCC ATGACGGCTCTCGCATATTAC
• crtYB-R TGCG GTCGAC TTACTGCCCTTCCCATCCGC
• CRTI-F GCG GGATCC ATGGGAAAAGAACAAGATCAGG
• CRTI-R TGCG GTCGAC TCAGAAAGCAAGAACACCAACG
• crtE-F CGC GGATCC ATGGATTACGCGAACATCCTC
• crtE-R TGCG GTCGAC TCACAGAGGGATATCGGCTAG

We designed different promoters in the middle of each carotene genes, and used overlap PCR to combine them together.

Sequence

The part consists of TEF1 promotor, crtE, tTDH3 promotor, crtI, tFBA1 promotor and crtYB. The expression of crtE is controlled by TEF1 promotor, the expression of crtI is controlled by tDH3 promotor,and the expression of crtYB is controlled by tFBA1 promotor.

Sequence and Features

Theory

Figure 1. The carotenogenic pathway.

crtYB, crtI, and crtE are originate from X. dendrorhous. Just as shown above, the carotenogenic pathway in X. dendrorhous consists of GGPP synthase encoded by crtE, the bifunctional enzyme phytoene synthase and lycopene cyclase encoded by crtYB, and phytoene desaturase encoded by crtI. S. cerevisiae contains a GGPP synthase, encoded by BTS1, which is able to convert FPP into GGPP. HMG1 encodes HMG-CoA reductase, which is the main regulatory point in the ergosterol biosynthetic pathway in many organisms. IPP, isopentenyl diphosphate; DMAP, dimethylallyl diphosphate; GPP, geranyl diphosphate. (René Verwaal, et al, 2007)

Like X. dendrorhous, S. cerevisiae is able to produce FPP and converts it into GGPP, the basic building block of carotenoids. Conversion of FPP into GGPP is catalyzed by GGPP synthase encoded by BTS1 in S. cerevisiae. Therefore, overexpression of only crtYB and crtI from X. dendrorhous in S. cerevisiae should generally be sufficient to transform S. cerevisiae into a β-carotene-producing organism. Additional overexpression of crtE from X. dendrorhous or BTS1 from S. cerevisiae will increase GGPP levels and thereby enhance β-carotene production.

Result

We succeeded to integrate this part into the chromosome of Saccharomyces cerevisiae by homologous recombination. With the expression of β-carotene, cell is orange. The result is showed below:

Figure 2. The result of transformation. The left side of the figure is the original Synthetic Saccharomyces cerevisiae, whose color is white. The orange strain on the right is the yeast what we obtained.

References

1. Verwaal, René et al. “High-Level Production of Beta-Carotene in Saccharomyces Cerevisiae by Successive Transformation with Carotenogenic Genes from X.anthophyllomyces Dendrorhous .” Applied and Environmental Microbiology 73.13 (2007): 4342–4350. PMC. Web. 27 Oct. 2017.

2. Mitchell, Leslie A. et al. “Versatile Genetic Assembly System (VEGAS) to Assemble Pathways for Expression in S. Cerevisiae.” Nucleic Acids Research 43.13 (2015): 6620–6630. PMC. Web. 27 Oct. 2017.