Difference between revisions of "Part:BBa K2382003"
LeeWeiYang (Talk | contribs) |
LeeWeiYang (Talk | contribs) |
||
Line 18: | Line 18: | ||
===Design Notes=== | ===Design Notes=== | ||
− | + | We use the T7 promotor from Part:BBa_K525998(Group: iGEM11_Bielefeld-Germany (2011-09-13)) | |
+ | >BBa_K525998 Part-only sequence (32 bp) | ||
+ | taatacgactcactatagggaaagaggagaaa | ||
+ | We add additional sequence on it. There are two function in our sequence follow the T7 promotor. One is lac operator, the other is RBS binding site. | ||
+ | |||
+ | Lac operator could be bound with lac repressor. It could stop the transcription to prevent making protein. Genome of E.coli has the lacI gene. It could translate the repressor to inhibit protein produced. That is, we design the lac operator into our sequence to prevent the leak of expressing protein. | ||
+ | RBS binding site could let the ribosome attach on the mRNA sequence to produce the enzyme. | ||
+ | These sequence is derived from pET-29a(+) sequence. Because the original part has the restriction site”Xba1”in the sequence, and the sequence of this restriction site is” TCTAGA. “ We do the single mutation to convert TC”T”AGA to TC”C”AGA . Thus, the restriction site would not be recognized by restriction enzyme and cut off. That is, it is safe to use to compose the sequence for igem. |
Revision as of 18:05, 27 October 2017
T7 promoter & Lac operator and RBS from PET-29a
This part originated from pET-29 a (+) Vectors and Part:BBa_K525998. It is composed of T7 promoter, Lac operator, and RBS. Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
We use the T7 promotor from Part:BBa_K525998(Group: iGEM11_Bielefeld-Germany (2011-09-13)) >BBa_K525998 Part-only sequence (32 bp) taatacgactcactatagggaaagaggagaaa We add additional sequence on it. There are two function in our sequence follow the T7 promotor. One is lac operator, the other is RBS binding site.
Lac operator could be bound with lac repressor. It could stop the transcription to prevent making protein. Genome of E.coli has the lacI gene. It could translate the repressor to inhibit protein produced. That is, we design the lac operator into our sequence to prevent the leak of expressing protein. RBS binding site could let the ribosome attach on the mRNA sequence to produce the enzyme. These sequence is derived from pET-29a(+) sequence. Because the original part has the restriction site”Xba1”in the sequence, and the sequence of this restriction site is” TCTAGA. “ We do the single mutation to convert TC”T”AGA to TC”C”AGA . Thus, the restriction site would not be recognized by restriction enzyme and cut off. That is, it is safe to use to compose the sequence for igem.