Difference between revisions of "Part:BBa K2407303"
Cccxyyyyyyyy (Talk | contribs) |
Cccxyyyyyyyy (Talk | contribs) (→Theory) |
||
Line 30: | Line 30: | ||
crtYB, crtI, and crtE are originate from X. dendrorhous. Just as shown above, the carotenogenic pathway in X. dendrorhous consists of GGPP synthase encoded by crtE, the bifunctional enzyme phytoene synthase and lycopene cyclase encoded by crtYB, and phytoene desaturase encoded by crtI. S. cerevisiae contains a GGPP synthase, encoded by BTS1, which is able to convert FPP into GGPP. HMG1 encodes HMG-CoA reductase, which is the main regulatory point in the ergosterol biosynthetic pathway in many organisms. IPP, isopentenyl diphosphate; DMAP, dimethylallyl diphosphate; GPP, geranyl diphosphate. (René Verwaal, et al, 2007) | crtYB, crtI, and crtE are originate from X. dendrorhous. Just as shown above, the carotenogenic pathway in X. dendrorhous consists of GGPP synthase encoded by crtE, the bifunctional enzyme phytoene synthase and lycopene cyclase encoded by crtYB, and phytoene desaturase encoded by crtI. S. cerevisiae contains a GGPP synthase, encoded by BTS1, which is able to convert FPP into GGPP. HMG1 encodes HMG-CoA reductase, which is the main regulatory point in the ergosterol biosynthetic pathway in many organisms. IPP, isopentenyl diphosphate; DMAP, dimethylallyl diphosphate; GPP, geranyl diphosphate. (René Verwaal, et al, 2007) | ||
+ | |||
+ | [[Image:Tianjin-_the_carotenogenic_pathway_in_X._dendrorhous.jpg|thumb|center|500px|'''Figure 3'''. Transformation results. The three dishes at the top of the picture contain a rich (YPD) medium. The three dishes at the bottom contain a selective (SD+Ade+His+Ura) medium. The yeast strains growing on ech plate are (A and D) 5523 with no plamids, (B and E) 5523 with only the pL2/GZ plasmid and (C and F) 5523 with the complete prionic system. Because the plasmids confer the ability to overcome the triptophan (pG1-NMGR<sup>526</sup>) and leucine (pL2/GZ) auxotrophies, only the prionic system-containing yeasts could grow on the selective medium. The rich medium impose no restriction for the growth of the three strains.]] | ||
+ | |||
Revision as of 06:19, 27 October 2017
β-carotene gene
A composite part of three key genes to produce β-carotene which can be expressed in Saccharomyces Cerevisiae.
Introduction
After reviewing the literature, we understand that carotene can be overexpressed in Saccharomyces cerevisiae. Furthermore, carotenoid production levels were higher in strains containing integrated carotenogenic genes. Overexpression of crtYB and crtI from X. dendrorhous was sufficient to enable carotenoid production. crtYB, crtI, and crtE can complete the expression of β-carotene, and the cell is orange.
Components of the Mating switcher
To characterize our Mating Switcher, we built a gene route to switch the expression from RFP to β-carotene. In this route, we combined RFP with TEF-1 promoter. To prevent leaky expression, we choose two kinds of terminators——ADH1 and Ura3‘s. So β-carotene’s expression is controlled by promoter-vox-RFP-Terminators-vox structure. Before the mating-type switch, our yeast presents reddish color due to RFP’s expression. After the Mating Switcher, with the deletion of RFP and terminators flanked by vox locus, β-carotene expresses and the strains take on an orange color. In Saccharomyces cerevisiae, these two colors are easy to distinguish. In this way, we can easily visualize the function of our switcher, as well as measure its efficiency and error rate.
This part was amplified by using the primers indicated by René Verwaal (2007), Some of those primers are:
- crtYB-F CGC GGATCC ATGACGGCTCTCGCATATTAC
- crtYB-R TGCG GTCGAC TTACTGCCCTTCCCATCCGC
- CRTI-F GCG GGATCC ATGGGAAAAGAACAAGATCAGG
- CRTI-R TGCG GTCGAC TCAGAAAGCAAGAACACCAACG
- crtE-F CGC GGATCC ATGGATTACGCGAACATCCTC
- crtE-R TGCG GTCGAC TCACAGAGGGATATCGGCTAG
We designed different promoters in the middle of each carotene genes, and used overlap PCR to combine them together.
Sequence
The part consists of TEF1 promotor, crtE, tTDH3 promotor, crtI, tFBA1 promotor and crtYB. The expression of crtE is controlled by TEF1 promotor, the expression of crtI is controlled by tDH3 promotor,and the expression of crtYB is controlled by tFBA1 promotor.
Theory
crtYB, crtI, and crtE are originate from X. dendrorhous. Just as shown above, the carotenogenic pathway in X. dendrorhous consists of GGPP synthase encoded by crtE, the bifunctional enzyme phytoene synthase and lycopene cyclase encoded by crtYB, and phytoene desaturase encoded by crtI. S. cerevisiae contains a GGPP synthase, encoded by BTS1, which is able to convert FPP into GGPP. HMG1 encodes HMG-CoA reductase, which is the main regulatory point in the ergosterol biosynthetic pathway in many organisms. IPP, isopentenyl diphosphate; DMAP, dimethylallyl diphosphate; GPP, geranyl diphosphate. (René Verwaal, et al, 2007)
![](/wiki/images/1/14/Tianjin-_the_carotenogenic_pathway_in_X._dendrorhous.jpg)
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 749
Illegal BglII site found at 2436
Illegal XhoI site found at 448
Illegal XhoI site found at 580
Illegal XhoI site found at 1399 - 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal AgeI site found at 616
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 3340
Illegal BsaI site found at 5695
Illegal BsaI.rc site found at 176
Illegal BsaI.rc site found at 6026
Illegal SapI site found at 2740