Difference between revisions of "Part:BBa K2350004:Design"

 
(Design Notes)
 
(11 intermediate revisions by the same user not shown)
Line 7: Line 7:
  
 
===Design Notes===
 
===Design Notes===
No
+
<h4>Primer</h4>
 
+
  
 +
<ol>
 +
<li>P0001
 +
  5' aattcgcggccgcttctagagttgacggctagctcagtcctaggtattgtgctagctactagagaaagaggagaaa 3'
 +
<li>P0002
 +
  5' agtatttctcctctttctctagtagctagcacaatacctaggactgagctagccgtcaactctagaagcggccgcg 3'
 +
<li>P0003
 +
  5' tactagatgagtaatttttcccgaag 3'
 +
<li>P0004
 +
  5' agatgagtaatttttcccgaag 3'
 +
<li>P0005
 +
  5' ttaagtctattaaagcttgaccaggcatcaaataaaacga 3'
 +
<li>P0006
 +
  5' tcgttttatttgatgcctggtcaagctttaatagacttaa 3'
 +
<li>P0007
 +
  5' tgcagcggccgctactagtatataaacgcagaaaggccca 3'
 +
<li>P0008
 +
  5' gcggccgctactagtatataaacgcagaaaggccca 3'
 +
</ol>
  
 
===Source===
 
===Source===
Line 16: Line 33:
  
 
===References===
 
===References===
 +
 +
<ul>
 +
<li>Koropatkin NM1, Pakrasi HB, Smith TJ. Atomic structure of a nitrate-binding protein crucial for photosynthetic productivity. 2006 Jun 27;103(26):9820-5. Epub 2006 Jun 15.
 +
<li>Ye Wang, Wenbin Li, Yaeesh Siddiqi, James R. Kinghorn, Shiela E. Unkles and Anthony D. M. Glass. Evidence for post-translational regulation of NrtA, the Aspergillus nidulans high-affinity nitrate transporter. DOI: 10.1111/j.1469-8137.2007.02135.x • Source: PubMed
 +
<li>Alexova R, Haynes PA, Ferrari BC, Neilan BA. Comparative protein expression in different strains of the bloom-forming cyanobacterium Microcystis aeruginosa. 2011 Sep;10(9):M110.003749. doi: 10.1074/mcp.M110.003749. Epub 2011 May 24.
 +
<li>Omata T, Ohmori M, Arai N, Ogawa T. Genetically engineered mutant of the cyanobacterium Synechococcus PCC 7942 defective in nitrate transport. Proc Natl Acad Sci U S A. 1989 Sep;86(17):6612-6.
 +
<li>Naureen Akhtar, Eugenia Karabika, James R. Kinghorn, Anthony D.M. Glass, Shiela E. Unkles, and Duncan A. Rouch. High-affinity nitrate/nitrite transporters NrtA and NrtB of Aspergillus nidulans exhibit high specificity and different inhibitor sensitivity. Microbiology. 2015 Jul; 161(Pt 7): 1435–1446. doi:  10.1099/mic.0.000088
 +
<li>James R. Kinghorn, Joan Sloan, Ghassan J. M. Kana'n, Edisio R. DaSilva, Duncan A. Rouch, and Shiela E. Unkles. Missense Mutations That Inactivate the Aspergillus nidulans nrtA Gene Encoding a High-Affinity Nitrate Transporter. Genetics. 2005 Mar; 169(3): 1369–1377. doi:  10.1534/genetics.104.036590
 +
<li>Maeda S, Omata T. Substrate-binding lipoprotein of the cyanobacterium Synechococcus sp. strain PCC 7942 involved in the transport of nitrate and nitrite. J Biol Chem. 1997 Jan 31;272(5):3036-41.
 +
</ul>

Latest revision as of 08:10, 24 October 2017


This part produces a part of nitrate channel protein from Synechocystis sp. PCC 6803


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 1179
    Illegal BamHI site found at 549
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

Primer

  1. P0001   5' aattcgcggccgcttctagagttgacggctagctcagtcctaggtattgtgctagctactagagaaagaggagaaa 3'
  2. P0002   5' agtatttctcctctttctctagtagctagcacaatacctaggactgagctagccgtcaactctagaagcggccgcg 3'
  3. P0003   5' tactagatgagtaatttttcccgaag 3'
  4. P0004   5' agatgagtaatttttcccgaag 3'
  5. P0005   5' ttaagtctattaaagcttgaccaggcatcaaataaaacga 3'
  6. P0006   5' tcgttttatttgatgcctggtcaagctttaatagacttaa 3'
  7. P0007   5' tgcagcggccgctactagtatataaacgcagaaaggccca 3'
  8. P0008   5' gcggccgctactagtatataaacgcagaaaggccca 3'

Source

This part produces a part of nitrate channel protein from Synechocystis sp. PCC 6803 .

References

  • Koropatkin NM1, Pakrasi HB, Smith TJ. Atomic structure of a nitrate-binding protein crucial for photosynthetic productivity. 2006 Jun 27;103(26):9820-5. Epub 2006 Jun 15.
  • Ye Wang, Wenbin Li, Yaeesh Siddiqi, James R. Kinghorn, Shiela E. Unkles and Anthony D. M. Glass. Evidence for post-translational regulation of NrtA, the Aspergillus nidulans high-affinity nitrate transporter. DOI: 10.1111/j.1469-8137.2007.02135.x • Source: PubMed
  • Alexova R, Haynes PA, Ferrari BC, Neilan BA. Comparative protein expression in different strains of the bloom-forming cyanobacterium Microcystis aeruginosa. 2011 Sep;10(9):M110.003749. doi: 10.1074/mcp.M110.003749. Epub 2011 May 24.
  • Omata T, Ohmori M, Arai N, Ogawa T. Genetically engineered mutant of the cyanobacterium Synechococcus PCC 7942 defective in nitrate transport. Proc Natl Acad Sci U S A. 1989 Sep;86(17):6612-6.
  • Naureen Akhtar, Eugenia Karabika, James R. Kinghorn, Anthony D.M. Glass, Shiela E. Unkles, and Duncan A. Rouch. High-affinity nitrate/nitrite transporters NrtA and NrtB of Aspergillus nidulans exhibit high specificity and different inhibitor sensitivity. Microbiology. 2015 Jul; 161(Pt 7): 1435–1446. doi: 10.1099/mic.0.000088
  • James R. Kinghorn, Joan Sloan, Ghassan J. M. Kana'n, Edisio R. DaSilva, Duncan A. Rouch, and Shiela E. Unkles. Missense Mutations That Inactivate the Aspergillus nidulans nrtA Gene Encoding a High-Affinity Nitrate Transporter. Genetics. 2005 Mar; 169(3): 1369–1377. doi: 10.1534/genetics.104.036590
  • Maeda S, Omata T. Substrate-binding lipoprotein of the cyanobacterium Synechococcus sp. strain PCC 7942 involved in the transport of nitrate and nitrite. J Biol Chem. 1997 Jan 31;272(5):3036-41.