Difference between revisions of "Part:BBa K2350003:Design"

Latest revision as of 07:23, 22 October 2017

Intrinsic promoter of Rubisco large subunit (PrbcL)

In order to overexpress foreign genes in the cyanobacteria, the intrinsic promoter of Rubisco large subunit (PrbcL) was chosen as the target for vector construction, which is retrieved from Synechoccocus elongatus PCC7942 genomic DNA in our experiment. PrbcL regulates the expression of the most abundant proteins in photosynthetic species and has been proven to have a high activity to express foreign genes, so we choose PrbcL as the promoter of our pigment gene. To insert PrbcL with EcoR1 and Pst1 cutting sites, we use site-directed mutagenesis to remove Pst1 cutting site in PrbcL nucleotide sequence.

Design Notes

1.Using fusion PCR, we fused PrbcL with desired pigment gene together.

Fusion PCR primers for PrbcL Forward:AATTC TGATGGAAAAAGCACTGTAA Reverse:tgtgtaatattattttctaa CATGTCGTCTCTCCCTAGAG

2.All Pst1 cutting sites in PrbcL were site-directed mutated.

Site-directed primers: Forward: GGACTTGCGCTGTGGGACTGGAGCTTTACAGGCTCCCCCT Reverse: GGACTTGCGCTGTGGGACTGGAGCTTTACAGGCTCCCCCT

3.Fusion PCR protocol of PrbcL and IndC

94 2min

94 20sec X5

51 30sec

68 4min30sec

Pause and add 2ul Fusion Primers

94 20sec

32.6 30sec

68 4min30sec

68 10min

Source

Synechococcus elongatus PCC 7942 gene sequence

References

Pei-Hong Chen, Hsien-Lin Liu, Yin-Ju Chen, Yi-Hsiang Cheng, Wei-Ling Lin, Chien-Hung Yeh and Chuan-Hsiung Chang (2012). Enhancing CO2 bio-mitigation by genetic engineering of cyanobacteria