Difference between revisions of "Part:BBa K2350003:Design"

(Design Notes)
(Source)
 
(4 intermediate revisions by 2 users not shown)
Line 3: Line 3:
 
<partinfo>BBa_K2350003 short</partinfo>
 
<partinfo>BBa_K2350003 short</partinfo>
  
<partinfo>BBa_K2350003 SequenceAndFeatures</partinfo>
+
In order to overexpress foreign genes in the cyanobacteria, the intrinsic promoter of Rubisco large subunit (PrbcL) was chosen as the target for vector construction, which is retrieved from Synechoccocus elongatus PCC7942 genomic DNA in our experiment.
 
+
In order to overexpress foreign genes in the cyanobacteria, the intrinsic promoter of Rubisco large subunit (PrbcL) was chosen as the target for vector construction, which is retrieved from pBR322 in our experiment.
+
 
PrbcL regulates the expression of the most abundant proteins in photosynthetic species and has been proven to have a high activity to express foreign genes, so we choose PrbcL as the promoter of our pigment gene.  
 
PrbcL regulates the expression of the most abundant proteins in photosynthetic species and has been proven to have a high activity to express foreign genes, so we choose PrbcL as the promoter of our pigment gene.  
 
To insert PrbcL with EcoR1 and Pst1 cutting sites, we use site-directed mutagenesis to remove Pst1 cutting site in PrbcL nucleotide sequence.  
 
To insert PrbcL with EcoR1 and Pst1 cutting sites, we use site-directed mutagenesis to remove Pst1 cutting site in PrbcL nucleotide sequence.  
  
 +
 +
 +
<partinfo>BBa_K2350003 SequenceAndFeatures</partinfo>
  
  
Line 28: Line 29:
  
 
94 2min
 
94 2min
 +
 
94 20sec X5
 
94 20sec X5
 +
 
51 30sec
 
51 30sec
 +
 
68 4min30sec
 
68 4min30sec
 +
 
Pause and add 2ul Fusion Primers
 
Pause and add 2ul Fusion Primers
 +
 
94 20sec
 
94 20sec
 +
 
32.6 30sec
 
32.6 30sec
 +
 
68 4min30sec
 
68 4min30sec
 +
 
68 10min
 
68 10min
  
 
===Source===
 
===Source===
  
pBR322 gene sequence
+
Synechococcus elongatus PCC 7942 gene sequence
  
 
===References===
 
===References===
  
 
Pei-Hong Chen, Hsien-Lin Liu, Yin-Ju Chen, Yi-Hsiang Cheng, Wei-Ling Lin, Chien-Hung Yeh and Chuan-Hsiung Chang (2012). Enhancing CO2 bio-mitigation by genetic engineering of cyanobacteria
 
Pei-Hong Chen, Hsien-Lin Liu, Yin-Ju Chen, Yi-Hsiang Cheng, Wei-Ling Lin, Chien-Hung Yeh and Chuan-Hsiung Chang (2012). Enhancing CO2 bio-mitigation by genetic engineering of cyanobacteria

Latest revision as of 07:23, 22 October 2017


Intrinsic promoter of Rubisco large subunit (PrbcL)

In order to overexpress foreign genes in the cyanobacteria, the intrinsic promoter of Rubisco large subunit (PrbcL) was chosen as the target for vector construction, which is retrieved from Synechoccocus elongatus PCC7942 genomic DNA in our experiment. PrbcL regulates the expression of the most abundant proteins in photosynthetic species and has been proven to have a high activity to express foreign genes, so we choose PrbcL as the promoter of our pigment gene. To insert PrbcL with EcoR1 and Pst1 cutting sites, we use site-directed mutagenesis to remove Pst1 cutting site in PrbcL nucleotide sequence.



Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

1.Using fusion PCR, we fused PrbcL with desired pigment gene together.

Fusion PCR primers for PrbcL Forward:AATTC TGATGGAAAAAGCACTGTAA Reverse:tgtgtaatattattttctaa CATGTCGTCTCTCCCTAGAG

2.All Pst1 cutting sites in PrbcL were site-directed mutated.

Site-directed primers: Forward: GGACTTGCGCTGTGGGACTGGAGCTTTACAGGCTCCCCCT Reverse: GGACTTGCGCTGTGGGACTGGAGCTTTACAGGCTCCCCCT

3.Fusion PCR protocol of PrbcL and IndC

94 2min

94 20sec X5

51 30sec

68 4min30sec

Pause and add 2ul Fusion Primers

94 20sec

32.6 30sec

68 4min30sec

68 10min

Source

Synechococcus elongatus PCC 7942 gene sequence

References

Pei-Hong Chen, Hsien-Lin Liu, Yin-Ju Chen, Yi-Hsiang Cheng, Wei-Ling Lin, Chien-Hung Yeh and Chuan-Hsiung Chang (2012). Enhancing CO2 bio-mitigation by genetic engineering of cyanobacteria