Difference between revisions of "Part:BBa K2273113"

 
Line 4: Line 4:
  
 
This Promoter is a part used in the Beta-Lactam Biosensor project of [http://2017.igem.org/Team:TU_Dresden iGEM Team TU Dresden 2017 (EncaBcillus - It's a trap!)].
 
This Promoter is a part used in the Beta-Lactam Biosensor project of [http://2017.igem.org/Team:TU_Dresden iGEM Team TU Dresden 2017 (EncaBcillus - It's a trap!)].
it controls the gene expression of the <i>penP</i> gene that codes for a beta-lactamase found in <i>Bacillus subtilise</i>. Yet there is not much known about the activity and activation of the beta-lactamase PenP in <i>B. subtilis</i>. The highest expression levels seem to be achieved when high salt concentrations occur. [http://www.subtiwiki.uni-goettingen.de/v3/gene/view/713BAB7190E1F86C55103049B29072F00E0DFFB3]
+
It controls the gene expression of the <i>penP</i> gene that codes for a beta-lactamase found in <i>Bacillus subtilise</i>. Yet there is not much known about the activity and activation of the beta-lactamase PenP in <i>B. subtilis</i>. The highest expression levels seem to be achieved when high salt concentrations occur. [http://www.subtiwiki.uni-goettingen.de/v3/gene/view/713BAB7190E1F86C55103049B29072F00E0DFFB3]
 
PenP belongs to the class of Hydrolases and is able to break down beta-lactam antibiotics. The enzyme PenP harbours a signal peptide sequence and is most likely secreted and localized outside of the cell. [http://www.uniprot.org/uniprot/P39824]
 
PenP belongs to the class of Hydrolases and is able to break down beta-lactam antibiotics. The enzyme PenP harbours a signal peptide sequence and is most likely secreted and localized outside of the cell. [http://www.uniprot.org/uniprot/P39824]
To investigate the influence that the presence of the beta-lactamase PenP in <i>B.subtilis</i> has on the sensitivity our biosensor, we analyzed the promoter activity of P<sub><i>penP</i></sub> under antibiotic stress conditions.  
+
To investigate the influence that the presence of the beta-lactamase PenP in <i>B.subtilis</i> has on the sensitivity our biosensor, we analyzed the promoter activity of P<sub><i>penP</i></sub> under antibiotic stress conditions. We amplified a short and a longer version of this promoter to potentially take into account all regulatory regions upstream of the <i>penP</i> gene.
  
 
This part features the RFC10 prefix and suffix:
 
This part features the RFC10 prefix and suffix:

Revision as of 13:10, 3 October 2017


Short version of the Promoter PpenP found in B. subtilis

This Promoter is a part used in the Beta-Lactam Biosensor project of [http://2017.igem.org/Team:TU_Dresden iGEM Team TU Dresden 2017 (EncaBcillus - It's a trap!)]. It controls the gene expression of the penP gene that codes for a beta-lactamase found in Bacillus subtilise. Yet there is not much known about the activity and activation of the beta-lactamase PenP in B. subtilis. The highest expression levels seem to be achieved when high salt concentrations occur. [http://www.subtiwiki.uni-goettingen.de/v3/gene/view/713BAB7190E1F86C55103049B29072F00E0DFFB3] PenP belongs to the class of Hydrolases and is able to break down beta-lactam antibiotics. The enzyme PenP harbours a signal peptide sequence and is most likely secreted and localized outside of the cell. [http://www.uniprot.org/uniprot/P39824] To investigate the influence that the presence of the beta-lactamase PenP in B.subtilis has on the sensitivity our biosensor, we analyzed the promoter activity of PpenP under antibiotic stress conditions. We amplified a short and a longer version of this promoter to potentially take into account all regulatory regions upstream of the penP gene.

This part features the RFC10 prefix and suffix:

Prefix with EcoRI, NotI, XbaI GAATTCGCGGCCGCTTCTAGA
Suffix with SpeI, NotI and PstI ACTAGTAGCGGCCGCTGCAGA

Sites of restriction enzymes generating compatible overhangs are indicated by sharing one color. (EcoRI and PstI are marked in blue, NotI in green, XbaI and SpeI in red)

Beta-Lactam Biosensor

In this subproject, we developed a functional and complete heterologous beta-lactam biosensor in Bacillus subtilis. By the time these specified cells sense a compound of the beta-lactam family, they will respond by producing a measurable luminescence signal. We further investigated the detection spectrum of the biosensor by testing different beta-lactam antibiotics from various subclasses. For increased control and easy handling of the biosensor strain during a potential field application, we demonstrate that the encapsulation of the cells into Peptidosomes is quite advantageous.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]