Difference between revisions of "Part:BBa K2273112"
Line 5: | Line 5: | ||
The promoter P<sub><i>blaR1I</i></sub> is a part used in the Beta-Lactam Biosensor project of [http://2017.igem.org/Team:TU_Dresden iGEM Team TU Dresden 2017 (EncaBcillus - It's a trap!)]. | The promoter P<sub><i>blaR1I</i></sub> is a part used in the Beta-Lactam Biosensor project of [http://2017.igem.org/Team:TU_Dresden iGEM Team TU Dresden 2017 (EncaBcillus - It's a trap!)]. | ||
− | This part is a composite of the <i>bla</i> operon found in <i>Staphylococcus aureus</i> and constitutes the promoter regulating gene expression of the genes blaR1 and blaI, encoding a beta-lactam receptor and a repressor protein regulating gene expression of the <i>bla</i> operon. If the microorganism is exposed to beta-lactam antibiotics, the receptor blaR1 [https://parts.igem.org/Part:BBa_K2273108] senses the compound and a signal is transduced into the cytoplasm. Subsequently, the <i>BlaI</i> repressor protein [https://parts.igem.org/Part:BBa_K2273110] is degraded and frees the P<sub><i>blaZ</i></sub> [https://parts.igem.org/Part:BBa_K2273111] promoter. Following, the genes <i>blaI, blaR1</i> and <i>blaZ</i> are transcribed and the beta-lactamase <i>blaZ</i> confers resistance to the antibiotic. | + | This part is a composite of the <i>bla</i> operon found in <i>Staphylococcus aureus</i> and constitutes the promoter regulating gene expression of the genes blaR1 and blaI, encoding a beta-lactam receptor and a repressor protein regulating gene expression of the <i>bla</i> operon. If the microorganism is exposed to beta-lactam antibiotics, the receptor blaR1 [https://parts.igem.org/Part:BBa_K2273108] senses the compound and a signal is transduced into the cytoplasm. Subsequently, the <i>BlaI</i> repressor protein [https://parts.igem.org/Part:BBa_K2273110] is degraded and frees the P<sub><i>blaR1I</i></sub> as well as the P<sub><i>blaZ</i></sub> [https://parts.igem.org/Part:BBa_K2273111] promoter. Following, the genes <i>blaI, blaR1</i> and <i>blaZ</i> are transcribed and the beta-lactamase <i>blaZ</i> confers resistance to the antibiotic. |
This part features the RFC10 prefix and suffix: | This part features the RFC10 prefix and suffix: |
Revision as of 10:31, 3 October 2017
PblaR1I Promoter found in Staphylococcus aureus
The promoter PblaR1I is a part used in the Beta-Lactam Biosensor project of [http://2017.igem.org/Team:TU_Dresden iGEM Team TU Dresden 2017 (EncaBcillus - It's a trap!)].
This part is a composite of the bla operon found in Staphylococcus aureus and constitutes the promoter regulating gene expression of the genes blaR1 and blaI, encoding a beta-lactam receptor and a repressor protein regulating gene expression of the bla operon. If the microorganism is exposed to beta-lactam antibiotics, the receptor blaR1 [1] senses the compound and a signal is transduced into the cytoplasm. Subsequently, the BlaI repressor protein [2] is degraded and frees the PblaR1I as well as the PblaZ [3] promoter. Following, the genes blaI, blaR1 and blaZ are transcribed and the beta-lactamase blaZ confers resistance to the antibiotic.
This part features the RFC10 prefix and suffix:
Prefix with | EcoRI, NotI, XbaI | GAATTCGCGGCCGCTTCTAGA |
Suffix with | SpeI, NotI and PstI | ACTAGTAGCGGCCGCTGCAGA |
Sites of restriction enzymes generating compatible overhangs are indicated by sharing one color. (EcoRI and PstI are marked in blue, NotI in green, XbaI and SpeI in red)
Beta-Lactam Biosensor
In this subproject, we developed a functional and complete heterologous beta-lactam biosensor in Bacillus subtilis. By the time these specified cells sense a compound of the beta-lactam family, they will respond by producing a measurable luminescence signal. We further investigated the detection spectrum of the biosensor by testing different beta-lactam antibiotics from various subclasses. For increased control and easy handling of the biosensor strain during a potential field application, we demonstrate that the encapsulation of the cells into Peptidosomes is quite advantageous.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]