Difference between revisions of "Help:BioBrick Prefix and Suffix"

(Basic Information)
m
 
(14 intermediate revisions by 3 users not shown)
Line 1: Line 1:
 +
[[Category:BioBrick RFC 10]]
 
==Basic Information==
 
==Basic Information==
 
{|
 
{|
Line 8: Line 9:
 
===Part Sequence===
 
===Part Sequence===
 
The DNA sequence for parts in the Registry starts with the first base of the part itself and ends with its last base.
 
The DNA sequence for parts in the Registry starts with the first base of the part itself and ends with its last base.
For example, a protein coding sequence is like this "ATG----------TAATAA". (Note: if you want to use your protein part with BioScaffold parts [https://parts.igem.org/BioScaffold_Parts] to do things like directly make protein fusions from your part [http://openwetware.org/wiki/The_BioBricks_Foundation:BBFRFC15] in the future, then you should make a version of your part that has only one stop codon "ATG----------TAA" instead of two.  Since the BioBrick scar that directly follows your part in assemblies also codes for a stop codon, you have the potential to get the same double stop effect even without direct addition of two stop codons after the protein coding region if you are careful to make sure another part always follows your protein coding part.) The sequence in the Registry does not include
+
For example, a protein coding sequence is like this "ATG----------TAATAA". The sequence in the Registry does not include
 
any bases of the BioBrick Prefix or Suffix.  
 
any bases of the BioBrick Prefix or Suffix.  
  
[[Help:Plasmids|Plasmids]] (see below) and primers or tags that explicitly specify prefix or suffix bases are exceptions to this rule.
+
[[Help:Plasmids|Plasmid Backbones]] and primers or tags that explicitly specify prefix or suffix bases are exceptions to this rule.
  
 
===BioBrick Prefix===
 
===BioBrick Prefix===
Line 55: Line 56:
 
===BioBrick Restriction Enzyme Cut Sites===
 
===BioBrick Restriction Enzyme Cut Sites===
 
{|width='80%' style='border:1px solid gray; margin-left:2em'
 
{|width='80%' style='border:1px solid gray; margin-left:2em'
|width='50%'|
+
|width='20%'|
Prefix                               Suffix
+
Prefix    
|width='50%' valign='top'|
+
|width='20%'|
<div style='font-family:monospace;font-size:175%;padding-left:1em;'>tactag</div>
+
                             
 +
|width='40%'|
 +
Suffix
 
|-
 
|-
|width='50%'|
+
|width='10%'|
EcoRI             XbaI               SpeI             PstI
+
EcoRI
|width='50%'|
+
|width='10%'|
<div style='font-family:monospace;font-size:175%;padding-left:1em'>tactagag</div>
+
XbaI
 +
|width='10%'|
 +
SpeI
 +
|width='10%'|
 +
PstI
 +
|-
 +
|width='10%'|
 +
(g^aatt c)gcggccgct
 +
|width='10%'|
 +
(t^ctag a)g
 +
|width='10%'|
 +
t(a^ctag t)agcggccg
 +
|width='10%'|
 +
(c tgca^g)
 +
|-
 +
|width='10%'|
 +
(c ttaa^g)cgccggcga
 +
|width='10%'|
 +
(a gatc^t)c
 +
|width='10%'|
 +
a(t gatc^a)tcgccggc
 +
|width='10%'|
 +
(g^acgt c)
 
|}
 
|}
  
{|width='80%' style='border:1px solid gray; margin-left:2em'
+
'''Footnotes'''
Prefix                                Suffix
+
1. If you want to use your protein part with BioScaffold parts [https://parts.igem.org/BioScaffold_Parts] to do things like directly make protein fusions from your part [http://openwetware.org/wiki/The_BioBricks_Foundation:BBFRFC15] in the future, then you should make a version of your part that has only one stop codon "ATG----------TAA" instead of two. Since the BioBrick scar that directly follows your part in assemblies also codes for a stop codon, you have the potential to get the same double stop effect even without direct addition of two stop codons after the protein coding region if you are careful to make sure another part always follows your protein coding part.
|width='80%'|
+
EcoRI              XbaI                SpeI              PstI
+
|width='50%'|   
+
(g^aatt c)gcggccgct(t^ctaga g)        t(a^ctag t)agcggccg(c tgca^g)  
+
|width='50%'| 
+
(c ttaa^g)cgccggcga(a gatct^c)        a(t gatc^a)tcgccggc(g^acgt c)
+
|}
+

Latest revision as of 19:46, 16 June 2017

Basic Information

Partinps.png

For more information about how the prefix and suffix were determined and the special case of coding regions, see Assembly:RBS-CDS_issues.

Part Sequence

The DNA sequence for parts in the Registry starts with the first base of the part itself and ends with its last base. For example, a protein coding sequence is like this "ATG----------TAATAA". The sequence in the Registry does not include any bases of the BioBrick Prefix or Suffix.

Plasmid Backbones and primers or tags that explicitly specify prefix or suffix bases are exceptions to this rule.

BioBrick Prefix

The standard BioBrick prefix depends on the part that follows it.

If the following part is a coding sequence or any other part that starts "ATG", the BioBrick prefix is:

gaattcgcggccgcttctag

Otherwise, the BioBrick prefix is:

gaattcgcggccgcttctagag


BioBrick Suffix

The standard BioBrick suffix is always:

tactagtagcggccgctgcag


BioBrick Scar

When BioBricks with these prefix and suffix sequencees are assembled, there is a "scar" between these parts.

If the second part starts "AT", the scar is:

tactag

Otherwise, the scar is:

tactagag


BioBrick Restriction Enzyme Cut Sites

Prefix

Suffix

EcoRI

XbaI

SpeI

PstI

(g^aatt c)gcggccgct

(t^ctag a)g

t(a^ctag t)agcggccg

(c tgca^g)

(c ttaa^g)cgccggcga

(a gatc^t)c

a(t gatc^a)tcgccggc

(g^acgt c)

Footnotes 1. If you want to use your protein part with BioScaffold parts [1] to do things like directly make protein fusions from your part [http://openwetware.org/wiki/The_BioBricks_Foundation:BBFRFC15] in the future, then you should make a version of your part that has only one stop codon "ATG----------TAA" instead of two. Since the BioBrick scar that directly follows your part in assemblies also codes for a stop codon, you have the potential to get the same double stop effect even without direct addition of two stop codons after the protein coding region if you are careful to make sure another part always follows your protein coding part.