Difference between revisions of "Help:BioBrick Prefix and Suffix"
m
 
(33 intermediate revisions by 6 users not shown)
Line 1: Line 1:
 +
[[Category:BioBrick RFC 10]]
 
==Basic Information==
 
==Basic Information==
 
{|
 
{|
Line 11: Line 12:
 
any bases of the BioBrick Prefix or Suffix.  
 
any bases of the BioBrick Prefix or Suffix.  
  
−
[[Help:Plasmids|Plasmids]] (see below) and primers or tags that explicitly specify prefix or suffix bases are exceptions to this rule.
+
[[Help:Plasmids|Plasmid Backbones]] and primers or tags that explicitly specify prefix or suffix bases are exceptions to this rule.
−
 
+
  
 
===BioBrick Prefix===
 
===BioBrick Prefix===
Line 54: Line 54:
  
  
−
==Additional information on Prefix and Suffix==
+
===BioBrick Restriction Enzyme Cut Sites===
−
 
+
{|width='80%' style='border:1px solid gray; margin-left:2em'
−
===BioBrick Prefix===
+
|width='20%'|
−
The standard BioBrick prefix depends on the part that follows it (<FONT COLOR="#BABABA">part in grey</FONT>, <FONT COLOR="#CC00FF">EcoRI</FONT>,<FONT COLOR="#FF5333"> XbaI</FONT>).  YOUR SEQUENCE as it should be entered into the database is in uppercase letters.
+
Prefix     
−
{|width='85%' style='border:1px solid gray; margin-left:2em'
+
|width='20%'|
−
|width='45%'|
+
                             
−
If the following part is a coding sequence or any other part that starts "ATG", the BioBrick prefix is:
+
|width='40%'|
−
|width='55%' valign='top'|
+
Suffix
−
'''<span style='font-family:monospace;font-size:175%;padding-left:1em;'><FONT COLOR="#CC00FF">gaattc</FONT>gcggccgct<FONT COLOR="#FF5333">tctag</FONT><FONT COLOR="#BABABA">ATG...</FONT></span>'''
+
 
|-
 
|-
−
|width='45%'|
+
|width='10%'|
−
Otherwise, the BioBrick prefix is:
+
EcoRI
−
|width='55%'|
+
|width='10%'|
−
'''<span style='font-family:monospace;font-size:175%;padding-left:1em'><FONT COLOR="#CC00FF">gaattc</FONT>gcggccgct<FONT COLOR="#FF5333">tctaga</FONT>g<FONT COLOR="#BABABA">CA...</FONT></span>'''
+
XbaI
 +
|width='10%'|
 +
SpeI
 +
|width='10%'|
 +
PstI
 +
|-
 +
|width='10%'|
 +
(g^aatt c)gcggccgct
 +
|width='10%'|
 +
(t^ctag a)g
 +
|width='10%'|
 +
t(a^ctag t)agcggccg
 +
|width='10%'|
 +
(c tgca^g)
 +
|-
 +
|width='10%'|
 +
(c ttaa^g)cgccggcga
 +
|width='10%'|
 +
(a gatc^t)c
 +
|width='10%'|
 +
a(t gatc^a)tcgccggc
 +
|width='10%'|
 +
(g^acgt c)
 
|}
 
|}
  
−
===BioBrick Suffix===
+
'''Footnotes'''
−
Similarly, the standard BioBrick prefix depends on the part that preceeds it. Whenever possible, the transcriptional start site of a promoter part should lie 2bp upstream of the SpeI site. (<FONT COLOR="#BABABA">part in grey</FONT>, <FONT COLOR="#CC00FF">PstI</FONT>,<FONT COLOR="#FF5333"> SpeI</FONT>).   YOUR SEQUENCE as it should be entered into the database is in uppercase letters. For help locating the transcription initiation site in your promoter part, try [http://www.fruitfly.org/seq_tools/promoter.html promoter prediction.]
+
1. If you want to use your protein part with BioScaffold parts [https://parts.igem.org/BioScaffold_Parts] to do things like directly make protein fusions from your part [http://openwetware.org/wiki/The_BioBricks_Foundation:BBFRFC15] in the future, then you should make a version of your part that has only one stop codon "ATG----------TAA" instead of two. Since the BioBrick scar that directly follows your part in assemblies also codes for a stop codon, you have the potential to get the same double stop effect even without direct addition of two stop codons after the protein coding region if you are careful to make sure another part always follows your protein coding part.
−
{|width='85%' style='border:1px solid gray; margin-left:2em'
+
−
|width='45%'|
+
−
The standard BioBrick suffix for most parts:
+
−
|width='55% 'valign='top'|
+
−
'''<span style='font-family:monospace;font-size:175%;padding-left:1em'><FONT COLOR="#BABABA">...AC</FONT>t<FONT COLOR="#FF5333">actagt</FONT>agcggccg<FONT COLOR="#CC00FF">ctgcag</FONT></span>'''
+
−
|-
+
−
|width='45%'|
+
−
For promoter parts, the transcriptional initiation site (in green) is placed 2 bp upstream of the SpeI site:
+
−
|width='55%'|
+
−
'''<span style='font-family:monospace;font-size:175%;padding-left:1em'><FONT COLOR="#BABABA">...CA</FONT><FONT COLOR="#00FF7F">C</FONT>t<FONT COLOR="#FF5333">actagt</FONT>agcggccg<FONT COLOR="#CC00FF">ctgcag</FONT></span>'''
+
−
|}
+

Latest revision as of 19:46, 16 June 2017

Basic Information

Partinps.png

For more information about how the prefix and suffix were determined and the special case of coding regions, see Assembly:RBS-CDS_issues.

Part Sequence

The DNA sequence for parts in the Registry starts with the first base of the part itself and ends with its last base. For example, a protein coding sequence is like this "ATG----------TAATAA". The sequence in the Registry does not include any bases of the BioBrick Prefix or Suffix.

Plasmid Backbones and primers or tags that explicitly specify prefix or suffix bases are exceptions to this rule.

BioBrick Prefix

The standard BioBrick prefix depends on the part that follows it.

If the following part is a coding sequence or any other part that starts "ATG", the BioBrick prefix is:

gaattcgcggccgcttctag

Otherwise, the BioBrick prefix is:

gaattcgcggccgcttctagag


BioBrick Suffix

The standard BioBrick suffix is always:

tactagtagcggccgctgcag


BioBrick Scar

When BioBricks with these prefix and suffix sequencees are assembled, there is a "scar" between these parts.

If the second part starts "AT", the scar is:

tactag

Otherwise, the scar is:

tactagag


BioBrick Restriction Enzyme Cut Sites

Prefix

Suffix

EcoRI

XbaI

SpeI

PstI

(g^aatt c)gcggccgct

(t^ctag a)g

t(a^ctag t)agcggccg

(c tgca^g)

(c ttaa^g)cgccggcga

(a gatc^t)c

a(t gatc^a)tcgccggc

(g^acgt c)

Footnotes 1. If you want to use your protein part with BioScaffold parts [1] to do things like directly make protein fusions from your part [http://openwetware.org/wiki/The_BioBricks_Foundation:BBFRFC15] in the future, then you should make a version of your part that has only one stop codon "ATG----------TAA" instead of two. Since the BioBrick scar that directly follows your part in assemblies also codes for a stop codon, you have the potential to get the same double stop effect even without direct addition of two stop codons after the protein coding region if you are careful to make sure another part always follows your protein coding part.