Difference between revisions of "Part:BBa K2012009"
m |
|||
| (9 intermediate revisions by 3 users not shown) | |||
| Line 2: | Line 2: | ||
__NOTOC__ | __NOTOC__ | ||
<partinfo>BBa_K2012009 short</partinfo> | <partinfo>BBa_K2012009 short</partinfo> | ||
| + | |||
| + | <span style="font-style:italic"><span style="font-style:normal"><span style="font-style:italic">cheZ</span> gene, </span><span style="font-style:normal">regulating the bacterial motility by decreasing the possibility of tumbling,</span></span><span> is </span><span></span><span></span><span></span><span></span><span></span><span></span><span>a chemotaxis relating gene</span><span style="font-style:italic"><span style="font-style:normal">, It is wildly used in iGEM to control the motility of bacteria. In igem 2016 HZAU-China's project, we successfully fused a reporter protein GFP(BBa_E0040) with CheZ through a 18bp GS linker to monitor the concentration of CheZ.<br/> | ||
| + | We have proved the function of emitting green light under certain exciting light and the function of improving motility by transform it into a <span style="font-style:italic">cheZ</span> lacking strain, CL1. </span></span> | ||
<div> <span style="color:rgb(40, 40, 40);font-family:arial, sans-serif;font-size:13px">These parts are present in plasmid pSB1C3, but there is also a constitutive promoter (J23100-derived) inserted into the XbaI site. So, for example, the EcoRI/PstI region of part K2012009 reads:</span><br/> | <div> <span style="color:rgb(40, 40, 40);font-family:arial, sans-serif;font-size:13px">These parts are present in plasmid pSB1C3, but there is also a constitutive promoter (J23100-derived) inserted into the XbaI site. So, for example, the EcoRI/PstI region of part K2012009 reads:</span><br/> | ||
</div> | </div> | ||
| − | <div><span>------------------------------------------------------------------------------------------------------------------</span><br/> | + | <div><span>------------------------------------------------------------------------------------------------------------------------------------------------</span><br/> |
Biobrick 5' XbaI J23100 XbaI <span style="font-weight:bold"> K2012009 </span> Biobrick 3' <br/> | Biobrick 5' XbaI J23100 XbaI <span style="font-weight:bold"> K2012009 </span> Biobrick 3' <br/> | ||
gaattcgcggccgcttctagaGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTtctaga<b><span style="font-weight:normal">...................................</span></b><span>actagtagcggccgctgcag</span> | gaattcgcggccgcttctagaGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTtctaga<b><span style="font-weight:normal">...................................</span></b><span>actagtagcggccgctgcag</span> | ||
--------------------------------------------------------------------------------------------------------------------------------------------------------------------- </div> | --------------------------------------------------------------------------------------------------------------------------------------------------------------------- </div> | ||
<p style="margin-top:0.4em;margin-bottom:0.5em;color:rgb(40, 40, 40);font-family:arial, sans-serif;font-size:13px">This feature in no way prevents the use of these parts in standard Biobrick assembly. Normal prefix insertion into EcoRI/XbaI will delete this promoter element. Suffix insertion into SpeI/PstI will retain this promoter, but it can of course be removed later by a prefix insertion.</p> | <p style="margin-top:0.4em;margin-bottom:0.5em;color:rgb(40, 40, 40);font-family:arial, sans-serif;font-size:13px">This feature in no way prevents the use of these parts in standard Biobrick assembly. Normal prefix insertion into EcoRI/XbaI will delete this promoter element. Suffix insertion into SpeI/PstI will retain this promoter, but it can of course be removed later by a prefix insertion.</p> | ||
| − | <p style="margin-top:0.4em;margin-bottom:0.5em;color:rgb(40, 40, 40);font-family:arial, sans-serif;font-size:13px">Note also that the base 5' to the SpeI site is allowed to float in these parts and is therefore rarely "T". The "G" downstream of the XbaI site obeys the standard. Because the database does not permit variation at this position, the predicted sequences of composite parts derived from these parts will be incorrect at this position.</p> | + | <p style="margin-top:0.4em;margin-bottom:0.5em;color:rgb(40, 40, 40);font-family:arial, sans-serif;font-size:13px">Note also that the base 5' to the SpeI site is allowed to float in these parts and is therefore rarely "T". The "G" downstream of the XbaI site obeys the standard. Because the database does not permit variation at this position, the predicted sequences of composite parts derived from these parts will be incorrect at this position.(some content are cited from J61100 part([https://parts.igem.org/Part:BBa_K819009 BBa_J61100]))</p> |
<html> | <html> | ||
| − | + | </br> | |
| + | </br> | ||
| + | <img src="https://static.igem.org/mediawiki/parts/9/97/T--HZAU--China--light_field_of_BBa_K2012009.png" style="width:400px;margin-left:5%;"/> | ||
| + | <img src="https://static.igem.org/mediawiki/parts/a/a5/T--HZAU--China--fluorescence_field_of_BBa_K2012009.png" style="width:400px;margin-right:5%;"/> | ||
| + | <p><b>Figure 1.</b> <i>E. coli</i> with BBa_K2012009 was observed under light field. <b>Figure 2.</b> <i>E. coli</i> with BBa_K2012009 was observed under fluorescence field.</p> | ||
| + | </br> | ||
| + | </br> | ||
| + | </br> | ||
</html> | </html> | ||
| − | |||
<!-- Add more about the biology of this part here | <!-- Add more about the biology of this part here | ||
===Usage and Biology=== | ===Usage and Biology=== | ||
Latest revision as of 15:22, 1 November 2016
RBS(J61100) and CheZ with fused with a GS linker and GFP in C teminal
cheZ gene, regulating the bacterial motility by decreasing the possibility of tumbling, is a chemotaxis relating gene, It is wildly used in iGEM to control the motility of bacteria. In igem 2016 HZAU-China's project, we successfully fused a reporter protein GFP(BBa_E0040) with CheZ through a 18bp GS linker to monitor the concentration of CheZ.
We have proved the function of emitting green light under certain exciting light and the function of improving motility by transform it into a cheZ lacking strain, CL1.
These parts are present in plasmid pSB1C3, but there is also a constitutive promoter (J23100-derived) inserted into the XbaI site. So, for example, the EcoRI/PstI region of part K2012009 reads:
------------------------------------------------------------------------------------------------------------------------------------------------
Biobrick 5' XbaI J23100 XbaI K2012009 Biobrick 3'
gaattcgcggccgcttctagaGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTtctaga...................................actagtagcggccgctgcag
This feature in no way prevents the use of these parts in standard Biobrick assembly. Normal prefix insertion into EcoRI/XbaI will delete this promoter element. Suffix insertion into SpeI/PstI will retain this promoter, but it can of course be removed later by a prefix insertion.
Note also that the base 5' to the SpeI site is allowed to float in these parts and is therefore rarely "T". The "G" downstream of the XbaI site obeys the standard. Because the database does not permit variation at this position, the predicted sequences of composite parts derived from these parts will be incorrect at this position.(some content are cited from J61100 part(BBa_J61100))
Figure 1. E. coli with BBa_K2012009 was observed under light field. Figure 2. E. coli with BBa_K2012009 was observed under fluorescence field.
Sequence and Features
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 1321