Difference between revisions of "Part:BBa K2012009"
m
 
(16 intermediate revisions by 3 users not shown)
Line 3: Line 3:
 
<partinfo>BBa_K2012009 short</partinfo>
 
<partinfo>BBa_K2012009 short</partinfo>
  
−
Bacteria movement related gene CheZ which fused with a GS linker and GFP in C teminal. We will use this part to charactise the expression of CheZ.
+
<span style="font-style:italic"><span style="font-style:normal"><span style="font-style:italic">cheZ</span> gene,&nbsp;</span><span style="font-style:normal">regulating the bacterial motility by &nbsp;decreasing the possibility of tumbling,</span></span><span>&nbsp;is&nbsp;</span><span></span><span></span><span></span><span></span><span></span><span></span><span>a chemotaxis relating gene</span><span style="font-style:italic"><span style="font-style:normal">, It is wildly used in iGEM to control the motility of bacteria.&nbsp;In igem 2016&nbsp;HZAU-China's project,&nbsp;we successfully fused&nbsp;a reporter protein GFP(BBa_E0040) with CheZ through a 18bp GS linker&nbsp;to monitor the concentration of CheZ.<br/>
 +
We have proved the function of emitting green light under certain exciting light and the function of improving motility by transform it into a <span style="font-style:italic">cheZ</span> lacking strain, CL1.&nbsp;&nbsp;</span></span>
 +
 
 +
<div>&nbsp;<span style="color:rgb(40, 40, 40);font-family:arial, sans-serif;font-size:13px">These parts are present in plasmid pSB1C3, but there is also a constitutive promoter (J23100-derived) inserted into the XbaI site. So, for example, the EcoRI/PstI region of part K2012009 reads:</span><br/>
 +
</div>
 +
<div><span>------------------------------------------------------------------------------------------------------------------------------------------------</span><br/>
 +
Biobrick 5' &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;&nbsp; XbaI &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;J23100 &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;&nbsp; XbaI &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; <span style="font-weight:bold">&nbsp; K2012009&nbsp; &nbsp; &nbsp; &nbsp;</span> &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;&nbsp;Biobrick 3' <br/>
 +
gaattcgcggccgcttctagaGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTtctaga<b><span style="font-weight:normal">...................................</span></b><span>actagtagcggccgctgcag</span>
 +
---------------------------------------------------------------------------------------------------------------------------------------------------------------------&nbsp;</div>
 +
<p style="margin-top:0.4em;margin-bottom:0.5em;color:rgb(40, 40, 40);font-family:arial, sans-serif;font-size:13px">This feature in no way prevents the use of these parts in standard Biobrick assembly. Normal prefix insertion into EcoRI/XbaI will delete this promoter element. Suffix insertion into SpeI/PstI will retain this promoter, but it can of course be removed later by a prefix insertion.</p>
 +
<p style="margin-top:0.4em;margin-bottom:0.5em;color:rgb(40, 40, 40);font-family:arial, sans-serif;font-size:13px">Note also that the base 5' to the SpeI site is allowed to float in these parts and is therefore rarely "T". The "G" downstream of the XbaI site obeys the standard. Because the database does not permit variation at this position, the predicted sequences of composite parts derived from these parts will be incorrect at this position.(some content are cited from J61100 part([https://parts.igem.org/Part:BBa_K819009 BBa_J61100]))</p>
 
<html>
 
<html>
−
These parts are present in plasmid pSB1A2, but there is also a constitutive promoter (J23100-derived) inserted into the XbaI site.  So, for example, the EcoRI/PstI region of part J61100 reads:
+
</br>
−
  Biobrick 5'    XbaI                    J23100              XbaI    '''RBS Part'''    Biobrick 3'
+
</br>
−
  gaattcgcggccgcttctagaGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTtctaga'''GAAAGAGGGGACAA'''actagtagcggccgctgcag
+
<img src="https://static.igem.org/mediawiki/parts/9/97/T--HZAU--China--light_field_of_BBa_K2012009.png" style="width:400px;margin-left:5%;"/>
−
 
+
<img src="https://static.igem.org/mediawiki/parts/a/a5/T--HZAU--China--fluorescence_field_of_BBa_K2012009.png" style="width:400px;margin-right:5%;"/>
−
This feature in no way prevents the use of these parts in standard Biobrick assembly.  Normal prefix insertion into EcoRI/XbaI will delete this promoter element. Suffix insertion into SpeI/PstI will retain this promoter, but it can of course be removed later by a prefix insertion.
+
<p><b>Figure 1.</b> <i>E. coli</i> with BBa_K2012009 was observed under light field.    <b>Figure 2.</b> <i>E. coli</i> with BBa_K2012009 was observed under fluorescence field.</p>
−
 
+
</br>
−
Note also that the base 5' to the SpeI site is allowed to float in these parts and is therefore rarely
+
</br>
−
"T". The "G" downstream of the XbaI site obeys the standard. Because the database does not permit variation at this position, the predicted sequences of composite parts derived from these parts will be incorrect at this position.
+
</br>
−
 
+
 
</html>
 
</html>
−
 
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here
 
===Usage and Biology===
 
===Usage and Biology===

Latest revision as of 15:22, 1 November 2016


RBS(J61100) and CheZ with fused with a GS linker and GFP in C teminal

cheZ gene, regulating the bacterial motility by  decreasing the possibility of tumbling, is a chemotaxis relating gene, It is wildly used in iGEM to control the motility of bacteria. In igem 2016 HZAU-China's project, we successfully fused a reporter protein GFP(BBa_E0040) with CheZ through a 18bp GS linker to monitor the concentration of CheZ.
We have proved the function of emitting green light under certain exciting light and the function of improving motility by transform it into a cheZ lacking strain, CL1.  

 These parts are present in plasmid pSB1C3, but there is also a constitutive promoter (J23100-derived) inserted into the XbaI site. So, for example, the EcoRI/PstI region of part K2012009 reads:
------------------------------------------------------------------------------------------------------------------------------------------------

Biobrick 5'            XbaI                                            J23100                                    XbaI             K2012009                      Biobrick 3'
gaattcgcggccgcttctagaGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTtctaga...................................actagtagcggccgctgcag

 

This feature in no way prevents the use of these parts in standard Biobrick assembly. Normal prefix insertion into EcoRI/XbaI will delete this promoter element. Suffix insertion into SpeI/PstI will retain this promoter, but it can of course be removed later by a prefix insertion.

Note also that the base 5' to the SpeI site is allowed to float in these parts and is therefore rarely "T". The "G" downstream of the XbaI site obeys the standard. Because the database does not permit variation at this position, the predicted sequences of composite parts derived from these parts will be incorrect at this position.(some content are cited from J61100 part(BBa_J61100))



Figure 1. E. coli with BBa_K2012009 was observed under light field. Figure 2. E. coli with BBa_K2012009 was observed under fluorescence field.




Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 1321