Difference between revisions of "Part:BBa K1937002"

 
 
(7 intermediate revisions by 2 users not shown)
Line 3: Line 3:
 
<partinfo>BBa_K1937002 short</partinfo>
 
<partinfo>BBa_K1937002 short</partinfo>
  
Part: BBa_K1937002 (pSB1C3-OriKan)
+
<b>Part: BBa_K1937002 (pSB1C3-OriKan)<br></b>
(Chassis E. coli/B. subtilis, carrier plasmid pSB1C3)
+
(Chassis <i>E. coli/B. subtilis</i>, carrier plasmid pSB1C3)<br>
Length: 2510 bp
+
Length: 2510 bp<br><br>
  
While Bacillus subtilis is of huge interest for a growing number of iGEM projects, it is not easy to develop new parts as it is required that they registered after sub-cloning in the E. coli plasmid pSB1C3. During the iGEM Toulouse 2016 project, we had the idea to create a part that could turn any pSB1C3-based plasmid in a shuttle vector (E. coli/B. subtilis).  
+
While <i>Bacillus subtilis</i> is of huge interest for a growing number of iGEM projects, it is not easy to develop new parts as it is required that they are registered after sub-cloning in the <i>E. coli</i> plasmid pSB1C3. During the iGEM Toulouse 2016 project, we had the idea to create a part that could turn any pSB1C3-based plasmid in a shuttle vector (<i>E. coli/B. subtilis</i>).  
This BioBrick is a part developed by the Toulouse 2016 iGEM team (http://2016.igem.org/Team:Toulouse_France)
+
This BioBrick is a part developed by the Toulouse 2016 iGEM team (http://2016.igem.org/Team:Toulouse_France).
 +
 
 +
More information available on the design page of the Registry (https://parts.igem.org/Part:BBa_K1937002:Design) and at http://2016.igem.org/Team:Toulouse_France/Description
 +
 
 +
=<b>Part: BBa_K1937002 (pSB1C3-OriKan)</b>=
 +
<b>(Chassis <i>E. coli/B. subtilis</i>, carrier plasmid pSB<sub>1</sub>C<sub>3</sub>)
 +
Length: 2510 bp</b>
 +
 
 +
<b>Background:</b>
 +
While <i>Bacillus subtilis</i> is of huge interest for a growing number of iGEM projects, it is not easy to develop new parts as it is required that they registered after sub-cloning in the <i>E. coli</i> plasmid pSB1C3. During the iGEM Toulouse 2016 project, we had the idea to create a part that could turn any pSB1C3-based plasmid in a shuttle vector (<i>E. coli/B. subtilis</i>).
 +
This BioBrick is a part developed by the Toulouse 2016 iGEM team (http://2016.igem.org/Team:Toulouse_France) from the pSB<sub>Bs</sub>0K-P (BBa_K823026) previously developed by the 2012 Munich iGEM team.
 +
 
 +
More information available at http://2016.igem.org/Team:Toulouse_France/Description
 +
 
 +
 
 +
 
 +
<b>Creation:</b>
 +
The BBa_K1937002 part contains the <i>repU</i> origin of replication of <i>B. subtilis</i> and the kanamycin resistance gene for <i>B. subtilis</i> (Figure 1).<br>
 +
[[file:BBa_K1937002-map.jpg|thumb|center|800px|<b>Figure 1:</b> scheme of the Orikan part with <i>Bacillus subtilis</i> origin <i>repU</i> and a kanamycine resistance cassette.]]
 +
<br>It was obtained by amplifying the repU-Kan region of pSB<sub>Bs</sub>0K-P (BBa_K1351040 or BBa_K823026) using primers OriKan forward (5’ cacagaatcaggggataacgcaggaaagaaACATGTAGTTATAAGTGACTAAACAAATAACTAAATAGATGGG) and OriKan reverse (5’ gttcctggccttttgctggccttttgctcaACATGTCGCAAAATGGCCCGATTTAAG). The resulting fragment was sub-cloned in the pSB<sub>1</sub>C<sub>3</sub> between the EcoRI and PstI restriction sites (Figure 2).
 +
<br>
 +
[[Image:Toulouse_France_backbone2.jpg|thumb|center|800px|<b>Figure 2:</b> creation of the OriKan cassette. Position of the primers are indicated by the blue arrow on pSB<sub>Bs</sub>0K-P (left part of the figure). The resulting PCR fragment is the blue pointed line. After digestion by EcoRI and PstI and ligation in the pSB1C3 plasmid, the resulting pSB1C3-OriKan plasmid was obtained (right part of the figure)]]
 +
<br>
 +
 +
<b>Validation:</b>
 +
We successfully transformed <i>E. coli</i> and selected clones on chloramphenicol. Likewise, we successfully transformed <i>B. subtilis</i> and selected clones on kanamycine. Presence of the pSB1C3-OriKan plasmid was demonstrated in <i>B. subtilis</i> by PCR checking (Figure 3).
 +
<br>
 +
[[Image:Toulouse_France_backbone3.jpg|thumb|center|400px|<b>Figure 3:</b> validation of the pSB1C3-Orikan presence in <i>B. subtilis.</i> PCR on colonies was performed using primers hybridizing in the kanamycine resistance gene and in the suffix. The colonies were issued from the transformation of B. subtilis by pSB1C3-Orikan (assays), by the pSB<sub>Bs</sub>0K-P plasmid (negative control), or from the transformation of E. coli by pSB1C3-Orikan (positive control).]]
 +
<br>The part sequence has been verified by sequencing.
 +
 
 +
More information available at http://2016.igem.org/Team:Toulouse_France/Description
 +
 
 +
 
 +
<b>Interest:</b>
 +
This part can be sub-cloned in any pSB1C3 plasmid to make it compatible with <i>B. subtilis</i>. It will therefore greatly simplified the use of <i>Bacillus subtilis</i> as a chassis and the registration of new <i>Bacillus</i>-aimed parts.
 +
 
 +
 
 +
 
 +
<br>
 +
 
 +
=<b>Sequence:</b>=
 +
 
 +
<html>
 +
 
 +
<style>
 +
 
 +
/*LAYOUT */
 +
.column  {
 +
padding: 10px 0px;
 +
float:left;
 +
background-color:white;
 +
}
 +
 
 +
.full_size {
 +
width:100%;
 +
word-wrap: break-word;
 +
}
 +
 
 +
 
 +
 
 +
</style>
 +
 
 +
<div class="column full_size" style="font-size:10px;">
 +
GTCTTCAAGAGTTCCTTAAGGAACGTACAGACGGCTTAAAAGCCTTTAAAAACGTTTTTAAGGGGTTTGTAGACAAGGTAAAGGATAAAACAGCACAATTCCAAGAAAAACACGATTTAGAACCTAAAAAGAACGAATTTGAACTAACTCATAACCGAGAGGTAAAAAAAGAACGAAGTCGAGATCAGGGAATGAGTTTATAAAATAAAAAAAGCACCTGAAAAGGTGTCTTTTTTTGATGGTTTTGAACTTGTTCTTTCTTATCTTGATACATATAGAAATAACGTCATTTTTATTTTAGTTGCTGAAAGGTGCGTTGAAGTGTTGGTATGTATGTGTTTTAAAGTATTGAAAACCCTTAAAATTGGTTGCACAGAAAAACCCCATCTGTTAAAGTTATAAGTGACTAAACAAATAACTAAATAGATGGGGGTTTCTTTTAATATTATGTGTCCTAATAGTAGCATTTATTCAGATGAAAAATCAAGGGTTTTAGTGGACAAGACAAAAAGTGGAAAAGTGAGACCATGGAGAGAAAAGAAAATCGCTAATGTTGATTACTTTGAACTTCTGCATATTCTTGAATTTAAAAAGGCTGAAAGAGTAAAAGATTGTGCTGAAATATTAGAGTATAAACAAAATCGTGAAACAGGCGAAAGAAAGTTGTATCGAGTGTGGTTTTGTAAATCCAGGCTTTGTCCAATGTGCAACTGGAGGAGAGCAATGAAACATGGCATTCAGTCACAAAAGGTTGTTGCTGAAGTTATTAAACAAAAGCCAACAGTTCGTTGGTTGTTTCTCACATTAACAGTTAAAAATGTTTATGATGGCGAAGAATTAAATAAGAGTTTGTCAGATATGGCTCAAGGATTTCGCCGAATGATGCAATATAAAAAAATTAATAAAAATCTTGTTGGTTTTATGCGTGCAACGGAAGTGACAATAAATAATAAAGATAATTCTTATAATCAGCACATGCATGTATTGGTATGTGTGGAACCAACTTATTTTAAGAATACAGAAAACTACGTGAATCAAAAACAATGGATTCAATTTTGGAAAAAGGCAATGAAATTAGACTATGATCCAAATGTAAAAGTTCAAATGATTCGACCGAAAAATAAATATAAATCGGATATACAATCGGCAATTGACGAAACTGCAAAATATCCTGTAAAGGATACGGATTTTATGACCGATGATGAAGAAAAGAATTTGAAACGTTTGTCTGATTTGGAGGAAGGTTTACACCGTAAAAGGTTAATCTCCTATGGTGGTTTGTTAAAAGAAATACATAAAAAATTAAACCTTGATGACACAGAAGAAGGCGATTTGATTCATACAGATGATGACGAAAAAGCCGATGAAGATGGATTTTCTATTATTGCAATGTGGAATTGGGAACGGAAAAATTATTTTATTAAAGAGTAGTTCAACAAACGGGCCAGTTTGTTGAAGATTAGATGCTATAATTGTTATTAAAAGGATTGAAGGATGCTTAGGAAGACGAGTTATTAATAGCTGAATAAGAACGGTGCTCTCCAAATATTCTTATTTAGAAAAGCAAATCTAAAATTATCTGAAAAGGGAATGAGAATAGTGAATGGACCAATAATAATGACTAGAGAAGAAAGAATGAAGATTGTTCATGAAATTAAGGAACGAATATTGGATAAATATGGGGATGATGTTAAGGCTATTGGTGTTTATGGCTCTCTTGGTCGTCAGACTGATGGGCCCTATTCGGATATTGAGATGATGTGTGTCATGTCAACAGAGGAAGCAGAGTTCAGCCATGAATGGACAACCGGTGAGTGGAAGGTGGAAGTGAATTTTGATAGCGAAGAGATTCTACTAGATTATGCATCTCAGGTGGAATCAGATTGGCCGCTTACACATGGTCAATTTTTCTCTATTTTGCCGATTTATGATTCAGGTGGATACTTAGAGAAAGTGTATCAAACTGCTAAATCGGTAGAAGCCCAAACGTTCCACGATGCGATTTGTGCCCTTATCGTAGAAGAGCTGTTTGAATATGCAGGCAAATGGCGTAATATTCGTGTGCAAGGACCGACAACATTTCTACCATCCTTGACTGTACAGGTAGCAATGGCAGGTGCCATGTTGATTGGTCTGCATCATCGCATCTGTTATACGACGAGCGCTTCGGTCTTAACTGAAGCAGTTAAGCAATCAGATCTTCCTTCAGGTTATGACCATCTGTGCCAGTTCGTAATGTCTGGTCAACTTTCCGACTCTGAGAAACTTCTGGAATCGCTAGAGAATTTCTGGAATGGGATTCAGGAGTGGACAGAACGACACGGATATATAGTGGATGTGTCAAAACGCATACCATTTTGAACGATGACCTCTAATAATTGTTAATCATGTTGGTTACGTATTTATTAACTTCTCCTAGTATTAGTAATTATCATGGCTGTCATGGCGCATTAACGGAATAAAGGGTGTGCTTAAATCGGGCCATTTTG
 +
 
 +
<br><br>
 +
 
 +
</div>
 +
 
 +
</html>
 +
 
 +
<b>Annotation:</b><br>
 +
repU : 431-1435<br>
 +
Kan : 1595-2365
  
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here
===Usage and Biology===
+
===Usage and Biology==
  
 
<!-- -->
 
<!-- -->

Latest revision as of 22:18, 29 October 2016


OriKan: a composite part to turn any pSB1C3 into a Bacillus plasmid

Part: BBa_K1937002 (pSB1C3-OriKan)
(Chassis E. coli/B. subtilis, carrier plasmid pSB1C3)
Length: 2510 bp

While Bacillus subtilis is of huge interest for a growing number of iGEM projects, it is not easy to develop new parts as it is required that they are registered after sub-cloning in the E. coli plasmid pSB1C3. During the iGEM Toulouse 2016 project, we had the idea to create a part that could turn any pSB1C3-based plasmid in a shuttle vector (E. coli/B. subtilis). This BioBrick is a part developed by the Toulouse 2016 iGEM team (http://2016.igem.org/Team:Toulouse_France).

More information available on the design page of the Registry (https://parts.igem.org/Part:BBa_K1937002:Design) and at http://2016.igem.org/Team:Toulouse_France/Description

Part: BBa_K1937002 (pSB1C3-OriKan)

(Chassis E. coli/B. subtilis, carrier plasmid pSB1C3) Length: 2510 bp

Background: While Bacillus subtilis is of huge interest for a growing number of iGEM projects, it is not easy to develop new parts as it is required that they registered after sub-cloning in the E. coli plasmid pSB1C3. During the iGEM Toulouse 2016 project, we had the idea to create a part that could turn any pSB1C3-based plasmid in a shuttle vector (E. coli/B. subtilis). This BioBrick is a part developed by the Toulouse 2016 iGEM team (http://2016.igem.org/Team:Toulouse_France) from the pSBBs0K-P (BBa_K823026) previously developed by the 2012 Munich iGEM team.

More information available at http://2016.igem.org/Team:Toulouse_France/Description


Creation: The BBa_K1937002 part contains the repU origin of replication of B. subtilis and the kanamycin resistance gene for B. subtilis (Figure 1).

Figure 1: scheme of the Orikan part with Bacillus subtilis origin repU and a kanamycine resistance cassette.


It was obtained by amplifying the repU-Kan region of pSBBs0K-P (BBa_K1351040 or BBa_K823026) using primers OriKan forward (5’ cacagaatcaggggataacgcaggaaagaaACATGTAGTTATAAGTGACTAAACAAATAACTAAATAGATGGG) and OriKan reverse (5’ gttcctggccttttgctggccttttgctcaACATGTCGCAAAATGGCCCGATTTAAG). The resulting fragment was sub-cloned in the pSB1C3 between the EcoRI and PstI restriction sites (Figure 2).

Figure 2: creation of the OriKan cassette. Position of the primers are indicated by the blue arrow on pSBBs0K-P (left part of the figure). The resulting PCR fragment is the blue pointed line. After digestion by EcoRI and PstI and ligation in the pSB1C3 plasmid, the resulting pSB1C3-OriKan plasmid was obtained (right part of the figure)


Validation: We successfully transformed E. coli and selected clones on chloramphenicol. Likewise, we successfully transformed B. subtilis and selected clones on kanamycine. Presence of the pSB1C3-OriKan plasmid was demonstrated in B. subtilis by PCR checking (Figure 3).

Figure 3: validation of the pSB1C3-Orikan presence in B. subtilis. PCR on colonies was performed using primers hybridizing in the kanamycine resistance gene and in the suffix. The colonies were issued from the transformation of B. subtilis by pSB1C3-Orikan (assays), by the pSBBs0K-P plasmid (negative control), or from the transformation of E. coli by pSB1C3-Orikan (positive control).


The part sequence has been verified by sequencing.

More information available at http://2016.igem.org/Team:Toulouse_France/Description


Interest: This part can be sub-cloned in any pSB1C3 plasmid to make it compatible with B. subtilis. It will therefore greatly simplified the use of Bacillus subtilis as a chassis and the registration of new Bacillus-aimed parts.



Sequence:

GTCTTCAAGAGTTCCTTAAGGAACGTACAGACGGCTTAAAAGCCTTTAAAAACGTTTTTAAGGGGTTTGTAGACAAGGTAAAGGATAAAACAGCACAATTCCAAGAAAAACACGATTTAGAACCTAAAAAGAACGAATTTGAACTAACTCATAACCGAGAGGTAAAAAAAGAACGAAGTCGAGATCAGGGAATGAGTTTATAAAATAAAAAAAGCACCTGAAAAGGTGTCTTTTTTTGATGGTTTTGAACTTGTTCTTTCTTATCTTGATACATATAGAAATAACGTCATTTTTATTTTAGTTGCTGAAAGGTGCGTTGAAGTGTTGGTATGTATGTGTTTTAAAGTATTGAAAACCCTTAAAATTGGTTGCACAGAAAAACCCCATCTGTTAAAGTTATAAGTGACTAAACAAATAACTAAATAGATGGGGGTTTCTTTTAATATTATGTGTCCTAATAGTAGCATTTATTCAGATGAAAAATCAAGGGTTTTAGTGGACAAGACAAAAAGTGGAAAAGTGAGACCATGGAGAGAAAAGAAAATCGCTAATGTTGATTACTTTGAACTTCTGCATATTCTTGAATTTAAAAAGGCTGAAAGAGTAAAAGATTGTGCTGAAATATTAGAGTATAAACAAAATCGTGAAACAGGCGAAAGAAAGTTGTATCGAGTGTGGTTTTGTAAATCCAGGCTTTGTCCAATGTGCAACTGGAGGAGAGCAATGAAACATGGCATTCAGTCACAAAAGGTTGTTGCTGAAGTTATTAAACAAAAGCCAACAGTTCGTTGGTTGTTTCTCACATTAACAGTTAAAAATGTTTATGATGGCGAAGAATTAAATAAGAGTTTGTCAGATATGGCTCAAGGATTTCGCCGAATGATGCAATATAAAAAAATTAATAAAAATCTTGTTGGTTTTATGCGTGCAACGGAAGTGACAATAAATAATAAAGATAATTCTTATAATCAGCACATGCATGTATTGGTATGTGTGGAACCAACTTATTTTAAGAATACAGAAAACTACGTGAATCAAAAACAATGGATTCAATTTTGGAAAAAGGCAATGAAATTAGACTATGATCCAAATGTAAAAGTTCAAATGATTCGACCGAAAAATAAATATAAATCGGATATACAATCGGCAATTGACGAAACTGCAAAATATCCTGTAAAGGATACGGATTTTATGACCGATGATGAAGAAAAGAATTTGAAACGTTTGTCTGATTTGGAGGAAGGTTTACACCGTAAAAGGTTAATCTCCTATGGTGGTTTGTTAAAAGAAATACATAAAAAATTAAACCTTGATGACACAGAAGAAGGCGATTTGATTCATACAGATGATGACGAAAAAGCCGATGAAGATGGATTTTCTATTATTGCAATGTGGAATTGGGAACGGAAAAATTATTTTATTAAAGAGTAGTTCAACAAACGGGCCAGTTTGTTGAAGATTAGATGCTATAATTGTTATTAAAAGGATTGAAGGATGCTTAGGAAGACGAGTTATTAATAGCTGAATAAGAACGGTGCTCTCCAAATATTCTTATTTAGAAAAGCAAATCTAAAATTATCTGAAAAGGGAATGAGAATAGTGAATGGACCAATAATAATGACTAGAGAAGAAAGAATGAAGATTGTTCATGAAATTAAGGAACGAATATTGGATAAATATGGGGATGATGTTAAGGCTATTGGTGTTTATGGCTCTCTTGGTCGTCAGACTGATGGGCCCTATTCGGATATTGAGATGATGTGTGTCATGTCAACAGAGGAAGCAGAGTTCAGCCATGAATGGACAACCGGTGAGTGGAAGGTGGAAGTGAATTTTGATAGCGAAGAGATTCTACTAGATTATGCATCTCAGGTGGAATCAGATTGGCCGCTTACACATGGTCAATTTTTCTCTATTTTGCCGATTTATGATTCAGGTGGATACTTAGAGAAAGTGTATCAAACTGCTAAATCGGTAGAAGCCCAAACGTTCCACGATGCGATTTGTGCCCTTATCGTAGAAGAGCTGTTTGAATATGCAGGCAAATGGCGTAATATTCGTGTGCAAGGACCGACAACATTTCTACCATCCTTGACTGTACAGGTAGCAATGGCAGGTGCCATGTTGATTGGTCTGCATCATCGCATCTGTTATACGACGAGCGCTTCGGTCTTAACTGAAGCAGTTAAGCAATCAGATCTTCCTTCAGGTTATGACCATCTGTGCCAGTTCGTAATGTCTGGTCAACTTTCCGACTCTGAGAAACTTCTGGAATCGCTAGAGAATTTCTGGAATGGGATTCAGGAGTGGACAGAACGACACGGATATATAGTGGATGTGTCAAAACGCATACCATTTTGAACGATGACCTCTAATAATTGTTAATCATGTTGGTTACGTATTTATTAACTTCTCCTAGTATTAGTAATTATCATGGCTGTCATGGCGCATTAACGGAATAAAGGGTGTGCTTAAATCGGGCCATTTTG

Annotation:
repU : 431-1435
Kan : 1595-2365


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 2196
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal AgeI site found at 1807
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 522
    Illegal SapI.rc site found at 2020