Difference between revisions of "Part:BBa K1983014:Design"
(→Source) |
|||
(3 intermediate revisions by the same user not shown) | |||
Line 7: | Line 7: | ||
===Design Notes=== | ===Design Notes=== | ||
+ | |||
+ | This part was intentionally designed with XbaI site between RBS ([https://parts.igem.org/Part:BBa_J61132 J61132]) and PheP gene ([https://parts.igem.org/Part:BBa_K1983013 K1983013]) because it was a precursor for two other parts: ([https://parts.igem.org/Part:BBa_K1983015 K1983015]) and ([https://parts.igem.org/Part:BBa_K1983016 K1983016]). These parts only differ in RBS, with ([https://parts.igem.org/Part:BBa_K1983014 K1983014]) having a high, ([https://parts.igem.org/Part:BBa_K1983014 K1983014]) having medium, and ([https://parts.igem.org/Part:BBa_K1983013 K1983013]) having low strength RBS. The two resulting parts have scars at the location of XbaI site, just as any conventional composite part. <br> | ||
+ | |||
+ | Since this composite biobrick ([https://parts.igem.org/Part:BBa_K1983014 K1983014]) is a full construct comprised of a promoter, RBS, coding gene and terminator, with XbaI it is more adaptable regarding the regulation of this gene. Having only an XbaI site in it, it can be still be combined with other biobricks when digested with SpeI and PstI. | ||
Line 25: | Line 29: | ||
===Source=== | ===Source=== | ||
− | + | This part is derived from ([https://parts.igem.org/Part:BBa_B0017 BBa_B0017]). Other parts are derived Escherichia coli and were synthesized by Integrate DNA Technologies. | |
===References=== | ===References=== |
Latest revision as of 21:37, 22 October 2016
PheP under constitutive promoter, high strength RBS and terminator
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 7
Illegal NheI site found at 30
Illegal NheI site found at 98 - 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
This part was intentionally designed with XbaI site between RBS (J61132) and PheP gene (K1983013) because it was a precursor for two other parts: (K1983015) and (K1983016). These parts only differ in RBS, with (K1983014) having a high, (K1983014) having medium, and (K1983013) having low strength RBS. The two resulting parts have scars at the location of XbaI site, just as any conventional composite part.
Since this composite biobrick (K1983014) is a full construct comprised of a promoter, RBS, coding gene and terminator, with XbaI it is more adaptable regarding the regulation of this gene. Having only an XbaI site in it, it can be still be combined with other biobricks when digested with SpeI and PstI.
Primers
Primers used for amplification of the fragment:
Uni-FW: GTAGAATTCGCGGCCGCTTCTAG
Uni-RV: GTAGACTGCAGCGGCCGCTACTAG
Primers used for colony PCR screening:
For pSB1C3:
VF2: tgccacctgacgtctaagaa
VR: attaccgcctttgagtgagc
Source
This part is derived from (BBa_B0017). Other parts are derived Escherichia coli and were synthesized by Integrate DNA Technologies.