Difference between revisions of "Part:BBa K2172009"
(One intermediate revision by the same user not shown) | |||
Line 5: | Line 5: | ||
This part is a gene circuit that can be used to test whether it is being expressed or not. It comprises of a ribosome binding site (RBS) for ribosomes to bind, a GST label for purification, a thrombin protease cleavage site plus a TEV protease cleavage site, a GFP detection unit, and a terminator. When transformed into bacteria, e.g. E. coli, it can be used to test whether the bacteria are expressing the part not. Other parts, such as the gene SmCPS1, can be inserted into this part via digestion on the thrombin site and the TEV site. | This part is a gene circuit that can be used to test whether it is being expressed or not. It comprises of a ribosome binding site (RBS) for ribosomes to bind, a GST label for purification, a thrombin protease cleavage site plus a TEV protease cleavage site, a GFP detection unit, and a terminator. When transformed into bacteria, e.g. E. coli, it can be used to test whether the bacteria are expressing the part not. Other parts, such as the gene SmCPS1, can be inserted into this part via digestion on the thrombin site and the TEV site. | ||
− | <!-- Add more about the biology of this part here | + | <!-- Add more about the biology of this part here--> |
+ | |||
+ | [[File:T--CIEI-BJ--yinjiangpart06zhen.jpg|600px|thumb|center|Fig.1 The above circuit is constructed mainly to test whether it can produces SmCPS1. ]] | ||
+ | |||
+ | |||
+ | '''Name: BBa_K2172009''' | ||
+ | |||
+ | '''TAC-F primer: TCTAGATGACAATTAATCATCGGCT''' | ||
+ | |||
+ | '''TE-R primer: ACTAGTATGTATTTAGAAAAATAAACAAATAGG''' | ||
+ | |||
+ | '''Description: '''Promoter and RBS added, GST labeled, coding with a Thrombin restriction enzyme cleavage site, GFP detector, and Terminator. | ||
+ | |||
+ | '''Length: '''1844bp | ||
+ | |||
+ | |||
+ | This circuit is responsible for producing SmCPS1 protein inserted between Thrombin protease and TEV, and used GFP to test whether the whole gene circuit working. Thus the gene circuit is able excrete SmCPS1 protein to achieve our final objective. If the circuit do work, it would result in the expression of the GFP gene and emission of green fluorescent light. | ||
+ | |||
+ | |||
+ | [[File:T--CIEI-BJ--yinjiangpart06yingguang.jpg|600px|thumb|center]] | ||
+ | |||
+ | Green fluorescent light of E. coli under microscope. The E. coli transformed from white to fluorescent Green, because GFP segment inserted into plasmid result in unique detective color. We obtained the average expressive value of the green fluorescence in the biobrick part. | ||
+ | |||
+ | |||
+ | [[File:T--CIEI-BJ--yinjiangpart06colony.jpg|600px|thumb|center]] | ||
+ | |||
+ | |||
+ | '''Tac Promoter (29bp): ''' | ||
+ | |||
+ | '''Function: '''The tac promoter, a strong hybrid promoter, is used to control and increase the expression levels of a target gene and is used in the over-expression of recombinant proteins, produced from the combination of promoters from the trp and lac operons. | ||
+ | |||
+ | '''Sequence: '''tgacaattaatcatcggctcgtataatgt | ||
+ | |||
+ | |||
+ | |||
+ | '''RBS (14bp): ''' | ||
+ | |||
+ | '''Function: '''A ribosome binding site (RBS) is a sequence of mRNA. It is used to lead the ribosome to the right position on the mRNA during the beginning of translation | ||
+ | |||
+ | '''Sequence:''' tcacacaggaaaca | ||
+ | |||
+ | |||
+ | |||
+ | '''GST (757bp):''' | ||
+ | |||
+ | '''Function: '''By inserting the GST DNA coding sequence next to protein of interest, the GST can be added to a protein of interest to purify the fusion protein from solution in a process known as a pull-down assay. The strong binding affinity of GFP beads coated with the compound can be added to the protein mixture. As a result, the protein of interest attached to the GST will stick to the beads, isolating the protein from the rest of those in solution. | ||
+ | |||
+ | '''Sequence:''' | ||
+ | atgtcccctatactaggttattggaaaattaagggccttgtgcaacccactcgacttcttttggaatatcttgaagaaaaatatgaagagcatttgtatgagcgcgatgaaggtgataaatggcg | ||
+ | |||
+ | aaacaaaaagtttgaattgggtttggagtttcccaatcttccttattatattgatggtgatgttaaattaacacagtctatggccatcatacgttatatagctgacaagcacaacatgttgggtggtt | ||
+ | |||
+ | gtccaaaagagcgtgcagagatttcaatgcttgaaggagcggttttggatattagatacggtgtttcgagaattgcatatagtaaagactttgaaactctcaaagttgattttcttagcaagctac | ||
+ | |||
+ | ctgaaatgctgaaaatgttcgaagatcgtttatgtcataaaacatatttaaatggtgatcatgtaacccatcctgacttcatgttgtatgacgctcttgatgttgttttatacatggacccaatgtgc | ||
+ | |||
+ | ctggatgcgttcccaaaattagtttgttttaaaaaacgtattgaagctatcccacaaattgataagtacttgaaatccagcaagtatatagcatggcctttgcagggctggcaagccacgtttggt | ||
+ | |||
+ | ggtggcgaccatcctccaaaatcggatctggttccgcgtggatccccgggaatttccggtggtggtggtggaattctagactccatgggtcgactcgagctcaagcttattcatcgtgactgac | ||
+ | |||
+ | |||
+ | |||
+ | '''Thrombin protease (18bp): ''' | ||
+ | |||
+ | '''Function:''' Thrombin protease, a DNA segment of pGEX-KG vector containing Bam Hl cloning site after GST, is one of the essential restriction enzyme cleavage site inserted into tanshinone gene circuit in order to purify the SmCPS1 enzyme. | ||
+ | |||
+ | Sequence: CTGGTTCCGCGTGGATCC | ||
+ | |||
+ | |||
+ | |||
+ | '''GFP (720bp): ''' | ||
+ | |||
+ | '''Function: '''The gene for the production of GFP is incorporated into the genome of the organism in the region of the DNA that codes for the target proteins and that is controlled by the same regulatory sequence; that is, the gene's regulatory sequence now controls the production of GFP, where expression of GFP can be used as a detection device for a particular characteristic. | ||
+ | |||
+ | '''Sequence: ''' | ||
+ | |||
+ | ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTC | ||
+ | |||
+ | CGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCG | ||
+ | |||
+ | TGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTA | ||
+ | |||
+ | CGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCAT | ||
+ | |||
+ | CGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCG | ||
+ | |||
+ | ACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACAC | ||
+ | |||
+ | CCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCA | ||
+ | |||
+ | CATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA | ||
+ | |||
+ | |||
+ | |||
+ | '''Terminator (160bp): ''' | ||
+ | |||
+ | '''Function: '''Termination (T terminator) is the DNA sequence of the RNA polymerase termination signal of transcription, which is a structure at A structure in the poly (A) site downstream around 160bp | ||
+ | |||
+ | '''Sequence: ''' | ||
+ | |||
+ | AGCGATAGCGGAGTGTATAATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTC | ||
+ | |||
+ | AGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATT | ||
+ | |||
+ | |||
===Usage and Biology=== | ===Usage and Biology=== | ||
Latest revision as of 02:34, 20 October 2016
Tac Promoter-RBS-GST-Thrombin Protease-GFP-Terminator
This part is a gene circuit that can be used to test whether it is being expressed or not. It comprises of a ribosome binding site (RBS) for ribosomes to bind, a GST label for purification, a thrombin protease cleavage site plus a TEV protease cleavage site, a GFP detection unit, and a terminator. When transformed into bacteria, e.g. E. coli, it can be used to test whether the bacteria are expressing the part not. Other parts, such as the gene SmCPS1, can be inserted into this part via digestion on the thrombin site and the TEV site.
Name: BBa_K2172009
TAC-F primer: TCTAGATGACAATTAATCATCGGCT
TE-R primer: ACTAGTATGTATTTAGAAAAATAAACAAATAGG
Description: Promoter and RBS added, GST labeled, coding with a Thrombin restriction enzyme cleavage site, GFP detector, and Terminator.
Length: 1844bp
This circuit is responsible for producing SmCPS1 protein inserted between Thrombin protease and TEV, and used GFP to test whether the whole gene circuit working. Thus the gene circuit is able excrete SmCPS1 protein to achieve our final objective. If the circuit do work, it would result in the expression of the GFP gene and emission of green fluorescent light.
Green fluorescent light of E. coli under microscope. The E. coli transformed from white to fluorescent Green, because GFP segment inserted into plasmid result in unique detective color. We obtained the average expressive value of the green fluorescence in the biobrick part.
Tac Promoter (29bp):
Function: The tac promoter, a strong hybrid promoter, is used to control and increase the expression levels of a target gene and is used in the over-expression of recombinant proteins, produced from the combination of promoters from the trp and lac operons.
Sequence: tgacaattaatcatcggctcgtataatgt
RBS (14bp):
Function: A ribosome binding site (RBS) is a sequence of mRNA. It is used to lead the ribosome to the right position on the mRNA during the beginning of translation
Sequence: tcacacaggaaaca
GST (757bp):
Function: By inserting the GST DNA coding sequence next to protein of interest, the GST can be added to a protein of interest to purify the fusion protein from solution in a process known as a pull-down assay. The strong binding affinity of GFP beads coated with the compound can be added to the protein mixture. As a result, the protein of interest attached to the GST will stick to the beads, isolating the protein from the rest of those in solution.
Sequence: atgtcccctatactaggttattggaaaattaagggccttgtgcaacccactcgacttcttttggaatatcttgaagaaaaatatgaagagcatttgtatgagcgcgatgaaggtgataaatggcg
aaacaaaaagtttgaattgggtttggagtttcccaatcttccttattatattgatggtgatgttaaattaacacagtctatggccatcatacgttatatagctgacaagcacaacatgttgggtggtt
gtccaaaagagcgtgcagagatttcaatgcttgaaggagcggttttggatattagatacggtgtttcgagaattgcatatagtaaagactttgaaactctcaaagttgattttcttagcaagctac
ctgaaatgctgaaaatgttcgaagatcgtttatgtcataaaacatatttaaatggtgatcatgtaacccatcctgacttcatgttgtatgacgctcttgatgttgttttatacatggacccaatgtgc
ctggatgcgttcccaaaattagtttgttttaaaaaacgtattgaagctatcccacaaattgataagtacttgaaatccagcaagtatatagcatggcctttgcagggctggcaagccacgtttggt
ggtggcgaccatcctccaaaatcggatctggttccgcgtggatccccgggaatttccggtggtggtggtggaattctagactccatgggtcgactcgagctcaagcttattcatcgtgactgac
Thrombin protease (18bp):
Function: Thrombin protease, a DNA segment of pGEX-KG vector containing Bam Hl cloning site after GST, is one of the essential restriction enzyme cleavage site inserted into tanshinone gene circuit in order to purify the SmCPS1 enzyme.
Sequence: CTGGTTCCGCGTGGATCC
GFP (720bp):
Function: The gene for the production of GFP is incorporated into the genome of the organism in the region of the DNA that codes for the target proteins and that is controlled by the same regulatory sequence; that is, the gene's regulatory sequence now controls the production of GFP, where expression of GFP can be used as a detection device for a particular characteristic.
Sequence:
ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTC
CGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCG
TGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTA
CGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCAT
CGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCG
ACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACAC
CCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCA
CATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA
Terminator (160bp):
Function: Termination (T terminator) is the DNA sequence of the RNA polymerase termination signal of transcription, which is a structure at A structure in the poly (A) site downstream around 160bp
Sequence:
AGCGATAGCGGAGTGTATAATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTC
AGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATT
Usage and Biology
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 747
Illegal XhoI site found at 1485 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 159