Difference between revisions of "Part:BBa C0171"

 
 
(3 intermediate revisions by 2 users not shown)
Line 5: Line 5:
 
same as C0071 except no LVA tag
 
same as C0071 except no LVA tag
  
 +
===Characterization===
 +
 +
Group: <b>Tokyo Tech 2016</b>
 +
 +
Author: Yoshio Takata
 +
 +
Summary of Improvement and Characterization:
 +
 +
I. Improved Prhl by iGEM 2014 Tokyo_Tech team and characterize RhlR assay 
 +
 +
II. Improvement of the wild type Prhl
 +
 +
III. Comparison of the improved Prhl by iGEM 2014 Tokyo_Tech team to our original improved Prhl
 +
 +
 +
<span style="margin-left: 10px;">We Tokyo Tech 2016 simulated our final genetic circuits and found that the circuits did not work, because Prhl strength was too weak. (see [http://2016.igem.org/Team:Tokyo_Tech  our work in Tokyo_Tech 2016 wiki]). We therefore considered using the improved Prhl (<partinfo>BBa_K1529310</partinfo>,<partinfo>BBa_K1529310</partinfo>) established by Tokyo_Tech 2014, but we noticed that they were inappropriate for two reasons (see [http://2016.igem.org/Team:Tokyo_Tech  our work in Tokyo_Tech 2016 wiki]). Then, we decided to improve Prhl Promoter and obtain our original improved Prhl (included in <partinfo>BBa_K1949060</partinfo>) that suited our goal.
 +
 +
<span style="margin-left: 10px;">Our purpose is to create strong Prhl for our final genetic circuits.
 +
This experiment consists of the three parts below.
 +
 +
I. Improved Prhl by iGEM 2014 Tokyo_Tech team and characterize rhlR assay 
 +
 +
II. Improvement of the native Prhl
 +
 +
III. Comparison of the improved Prhl by iGEM 2014 Tokyo_Tech team to our original improved Prhl
 +
 +
The past improved Prhl did not suit for our final circuits and we could create the improved Prhl appropriate to our final circuits.
 +
 +
 +
====I. Improved Prhl by iGEM 2014 Tokyo_Tech item and characterize RhlR assay==== 
 +
 +
<span style="margin-left: 10px;">We found that Prhl(RL) (<partinfo>BBa_K1529300</partinfo>) activity was weak and the expression level depended on LVA tag (Fig.1); LVA-tagged proteins are prone to be degraded by cellular proteases. Prhl(LR) (<partinfo>BBa_K1529310</partinfo>) activity was strong and unexpectedly reacted with C12 (crosstalk) (Fig.3).
 +
 +
[[Image:prhl1.png|thumb|center|400px|Fig.1 Comparison of the Past improved Prhl  and RhlR ]]<br>
 +
 +
<span style="margin-left: 10px;">The colonies of transformants with a rhlR (<partinfo>BBa_C0171</partinfo>) plasmid looked rough and the growth rate was low(Fig.2-left), while the colonies of transformants with a rhlR-LVA (<partinfo>BBa_C0071</partinfo>) plasmid looked smooth and the growth rate was normal(Fig.2-right). However, the reason for this result is unclear.
 +
 +
[[Image:prhl2.png|thumb|center|400px|Fig.2 The colonies of transformants with a rhlR (left) or a rhlR-LVA (right)]]<br>
 +
 +
 +
====II. Improvement the wild type Prhl====
 +
 +
<span style="margin-left: 10px;">By introducing a single point mutation into wild type Prhl (<partinfo>BBa_R0071</partinfo>) by PCR, we obtained 198 Prhl mutants and chose the two Prhl mutants of which promoter activity was stronger than wild type Prhl(Fig.3).
 +
 +
[[Image:prhl4.png|thumb|center|400px|Fig. 3 RFU of GFP / turbidity of imoroved Prhl mutants]]<br>
 +
 +
The sequences of these two chosen mutants are shown below. The small characters indicate the scar sequence and a single point mutation is colored with red.
 +
 +
 +
Native Prhl (<partinfo>BBa_R0071</partinfo>)
 +
 +
TCCTGTGAAATCTGGCAGTTACCGTTAGCTTTCGAATTGGCTAAAAAGTGTTC
 +
 +
Prhl(NM)(<partinfo>BBa_K1949060</partinfo>)
 +
 +
TCCTGTGAAATCTGGCAGTTACCGTTAGCTTTCGAATTGGCTA<font color=#ff0000><b>t</b></font>AAAGTGTTC
 +
 +
====III. Comparison the improved Prhl by iGEM 2014 Tokyo_Tech team to our original improved Prhl====
 +
 +
<span style="margin-left: 10px;">Prhl(NM) was chosen from the many Prhl mutants, and by comparing Prhl(NM) to Prhl(LR), we obtained the result below (Fig.4). The reaction activity of Prhl(NM) to C4 was stronger than that of Prhl(LR), and Prhl(NM) did not react with C12 at all.
 +
 +
[[Image:prhl.png|thumb|center|400px|Fig.4 Comparison of Prhl(NM) to Prhl(LR)]]<br>
 +
 +
If you want more information, you see [http://2016.igem.org/Team:Tokyo_Tech  our work in Tokyo_Tech 2016 wiki]!
 +
 +
<!-- Add more about the biology of this part here
 
===Usage and Biology===
 
===Usage and Biology===
−
-- Please enter your experience with this part here --
 
  
 +
<!-- -->
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
 
<partinfo>BBa_C0171 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_C0171 SequenceAndFeatures</partinfo>
  
 +
 +
<!-- Uncomment this to enable Functional Parameter display
 
===Functional Parameters===
 
===Functional Parameters===
 
<partinfo>BBa_C0171 parameters</partinfo>
 
<partinfo>BBa_C0171 parameters</partinfo>
 +
<!-- -->

Latest revision as of 20:57, 19 October 2016


rhlR repressor/activator from P. aeruginosa PA3477 (no LVA)

same as C0071 except no LVA tag

Characterization

Group: Tokyo Tech 2016

Author: Yoshio Takata

Summary of Improvement and Characterization:

I. Improved Prhl by iGEM 2014 Tokyo_Tech team and characterize RhlR assay

II. Improvement of the wild type Prhl

III. Comparison of the improved Prhl by iGEM 2014 Tokyo_Tech team to our original improved Prhl


We Tokyo Tech 2016 simulated our final genetic circuits and found that the circuits did not work, because Prhl strength was too weak. (see [http://2016.igem.org/Team:Tokyo_Tech our work in Tokyo_Tech 2016 wiki]). We therefore considered using the improved Prhl (BBa_K1529310,BBa_K1529310) established by Tokyo_Tech 2014, but we noticed that they were inappropriate for two reasons (see [http://2016.igem.org/Team:Tokyo_Tech our work in Tokyo_Tech 2016 wiki]). Then, we decided to improve Prhl Promoter and obtain our original improved Prhl (included in BBa_K1949060) that suited our goal.

Our purpose is to create strong Prhl for our final genetic circuits. This experiment consists of the three parts below.

I. Improved Prhl by iGEM 2014 Tokyo_Tech team and characterize rhlR assay

II. Improvement of the native Prhl

III. Comparison of the improved Prhl by iGEM 2014 Tokyo_Tech team to our original improved Prhl

The past improved Prhl did not suit for our final circuits and we could create the improved Prhl appropriate to our final circuits.


I. Improved Prhl by iGEM 2014 Tokyo_Tech item and characterize RhlR assay

We found that Prhl(RL) (BBa_K1529300) activity was weak and the expression level depended on LVA tag (Fig.1); LVA-tagged proteins are prone to be degraded by cellular proteases. Prhl(LR) (BBa_K1529310) activity was strong and unexpectedly reacted with C12 (crosstalk) (Fig.3).

Fig.1 Comparison of the Past improved Prhl and RhlR

The colonies of transformants with a rhlR (BBa_C0171) plasmid looked rough and the growth rate was low(Fig.2-left), while the colonies of transformants with a rhlR-LVA (BBa_C0071) plasmid looked smooth and the growth rate was normal(Fig.2-right). However, the reason for this result is unclear.

Fig.2 The colonies of transformants with a rhlR (left) or a rhlR-LVA (right)


II. Improvement the wild type Prhl

By introducing a single point mutation into wild type Prhl (BBa_R0071) by PCR, we obtained 198 Prhl mutants and chose the two Prhl mutants of which promoter activity was stronger than wild type Prhl(Fig.3).

Fig. 3 RFU of GFP / turbidity of imoroved Prhl mutants

The sequences of these two chosen mutants are shown below. The small characters indicate the scar sequence and a single point mutation is colored with red.


Native Prhl (BBa_R0071)

TCCTGTGAAATCTGGCAGTTACCGTTAGCTTTCGAATTGGCTAAAAAGTGTTC

Prhl(NM)(BBa_K1949060)

TCCTGTGAAATCTGGCAGTTACCGTTAGCTTTCGAATTGGCTAtAAAGTGTTC

III. Comparison the improved Prhl by iGEM 2014 Tokyo_Tech team to our original improved Prhl

Prhl(NM) was chosen from the many Prhl mutants, and by comparing Prhl(NM) to Prhl(LR), we obtained the result below (Fig.4). The reaction activity of Prhl(NM) to C4 was stronger than that of Prhl(LR), and Prhl(NM) did not react with C12 at all.

Fig.4 Comparison of Prhl(NM) to Prhl(LR)

If you want more information, you see [http://2016.igem.org/Team:Tokyo_Tech our work in Tokyo_Tech 2016 wiki]!

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BamHI site found at 240
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI site found at 715