Difference between revisions of "Part:BBa K2040100:Experience"

 
(→‎Applications of BBa_K2040100)
 
(5 intermediate revisions by the same user not shown)
Line 1: Line 1:
  
 
__NOTOC__
 
__NOTOC__
−
This experience page is provided so that any user may enter their experience using this part.<BR>Please enter
+
 
−
how you used this part and how it worked out.
+
  
 
===Applications of BBa_K2040100===
 
===Applications of BBa_K2040100===
 +
We used
 +
forward primer
 +
5' ACGTCCTGCAGAATCATGCAGCGCTATGAG 3'
 +
& reverse primer
 +
5' ATAAGCGGCCGCCATGATGGTCTAGGGAACG 3'
 +
to extract ''PMcl1'' and its 5'-untranslated region (99bp downstream the promoter) from genomic DNA of ''Metarhizium anisopliae''. The whole length is 2772bp.
 +
 +
[[Image:PMcl1_PCR.png|left|250px|thumb|Figure1. Amplify ''PMcl1'' from gDNA]]
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
Then we digested the DNA fragment with NotI and PstI in order to insert it into the backbone. However, when we ran gel electrophoresis to check the digestion result, we found that there is still one PstI restriction site inside the ''PMcl1'' whcih is the one we did not know when we designed.
 +
 +
[[Image:PMcl1 digest.jpeg|left|250px|thumb|Figure2. PMcl1 fragment was broken]]
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
 +
We decided to sequence this DNA fragment we extracted and mutate the PstI site, but we didn't have enough time to finish our relative vectors construction.
  
 
===User Reviews===
 
===User Reviews===

Latest revision as of 17:12, 19 October 2016



Applications of BBa_K2040100

We used forward primer 5' ACGTCCTGCAGAATCATGCAGCGCTATGAG 3' & reverse primer 5' ATAAGCGGCCGCCATGATGGTCTAGGGAACG 3' to extract PMcl1 and its 5'-untranslated region (99bp downstream the promoter) from genomic DNA of Metarhizium anisopliae. The whole length is 2772bp.

Figure1. Amplify PMcl1 from gDNA
















Then we digested the DNA fragment with NotI and PstI in order to insert it into the backbone. However, when we ran gel electrophoresis to check the digestion result, we found that there is still one PstI restriction site inside the PMcl1 whcih is the one we did not know when we designed.

Figure2. PMcl1 fragment was broken















We decided to sequence this DNA fragment we extracted and mutate the PstI site, but we didn't have enough time to finish our relative vectors construction.

User Reviews

UNIQdac82f91a6a21b76-partinfo-00000000-QINU UNIQdac82f91a6a21b76-partinfo-00000001-QINU