Difference between revisions of "Part:BBa K2040100:Experience"

(Applications of BBa_K2040100)
(Applications of BBa_K2040100)
Line 9: Line 9:
 
& reverse primer  
 
& reverse primer  
 
5' ATAAGCGGCCGCCATGATGGTCTAGGGAACG 3'  
 
5' ATAAGCGGCCGCCATGATGGTCTAGGGAACG 3'  
to extract PMcl1 and its 5' untranslated region (99bp downstream the promoter) from genomic DNA of ''Metarhizium anisopliae''. The whole length is 2772bp.
+
to extract ''PMcl1'' and its 5' untranslated region (99bp downstream the promoter) from genomic DNA of ''Metarhizium anisopliae''. The whole length is 2772bp.
  
[[Image:PMcl1_PCR.png|left|250px|thumb|Figure1. Amplify PMcl1 from gDNA]]
+
[[Image:PMcl1_PCR.png|left|250px|thumb|Figure1. Amplify ''PMcl1'' from gDNA]]
  
  
Line 43: Line 43:
  
  
Then we digested the DNA fragment with NotI and PstI in order to insert it into the backbone. However, when we ran gel electrophoresis to check the digestion result, we found that there is still one PstI restriction site inside the PMcl1 whcih is the one we did not know when we designed.
+
Then we digested the DNA fragment with NotI and PstI in order to insert it into the backbone. However, when we ran gel electrophoresis to check the digestion result, we found that there is still one PstI restriction site inside the ''PMcl1'' whcih is the one we did not know when we designed.
  
 
[[Image:PMcl1 digest.jpeg|left|250px|thumb|Figure2. PMcl1 fragment was broken]]
 
[[Image:PMcl1 digest.jpeg|left|250px|thumb|Figure2. PMcl1 fragment was broken]]

Revision as of 17:12, 19 October 2016



Applications of BBa_K2040100

We used forward primer 5' ACGTCCTGCAGAATCATGCAGCGCTATGAG 3' & reverse primer 5' ATAAGCGGCCGCCATGATGGTCTAGGGAACG 3' to extract PMcl1 and its 5' untranslated region (99bp downstream the promoter) from genomic DNA of Metarhizium anisopliae. The whole length is 2772bp.

Figure1. Amplify PMcl1 from gDNA
















Then we digested the DNA fragment with NotI and PstI in order to insert it into the backbone. However, when we ran gel electrophoresis to check the digestion result, we found that there is still one PstI restriction site inside the PMcl1 whcih is the one we did not know when we designed.

Figure2. PMcl1 fragment was broken















We decided to sequence this DNA fragment we extracted and mutate the PstI site, but we didn't have enough time to finish our relative vectors construction.

User Reviews

UNIQ4b80c847f248daa9-partinfo-00000000-QINU UNIQ4b80c847f248daa9-partinfo-00000001-QINU