Difference between revisions of "Part:BBa K2060000:Design"

 
(→‎Design Notes)
 
(11 intermediate revisions by the same user not shown)
Line 7: Line 7:
  
 
===Design Notes===
 
===Design Notes===
−
Used standard design considerations for guide RNAs
+
One of the Cardiff_Wales iGEM instructors Daniel Pass, designed a [https://github.com/passdan/scriptdrop/blob/master/cas9_targeter.py bioinformatic tool]for the selection of appropriate guide RNAs from <i>E.coli</i> ribosomal 16S RNA that adhered to the following rules:
 +
<html>
 +
      <p> - The 3' end of the DNA target sequence must have a proto-spacer adjacent motif (PAM) sequence (5'-NGG-3').
 +
      <p>  - The 20 nucleotides upstream of the PAM sequence will be your targeting sequence (crRNA) and Cas9 nuclease will cleave approximately 3 bases upstream of the PAM.
 +
      <p> - The PAM sequence itself is absolutely required for cleavage, but it is NOT part of the sgRNA sequence and therefore should not be included in the sgRNA.
 +
        <p>- The target sequence can be on either DNA strand.
  
 +
<p>From this <a href="https://github.com/passdan/scriptdrop/blob/master/cas9_targeter.py">program</a>we identified the the following 'R1' guide sequence: <b>GGTGGGGTAACGGCTCACCA</b>
  
 +
<p>This guide sequence was added to the conserved DNA scaffold sequence that will interact with bacterial Cas9: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT
 +
 +
<p>This was synthesised by <a href="https://www.idtdna.com/pages/products/genes/gblocks-gene-fragments">IDT gBlock</a> as a single fragment together with the biobrick Prefix and Suffix and directly cloned into pSB1C3 using EcoRI and PstI.
 +
 +
<img width=50% src=https://static.igem.org/mediawiki/2016/5/53/T--Cardiff_Wales--GuideR1.png>
 +
</html>
  
 
===Source===
 
===Source===
  
−
E.coli 16S ribosomal RNA
+
<i>E.coli</i> 16S ribosomal RNA
  
 
===References===
 
===References===

Latest revision as of 13:04, 19 October 2016


CRISPR-Cas9 guide RNA targeting to 16S RNA


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal AgeI site found at 48
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

One of the Cardiff_Wales iGEM instructors Daniel Pass, designed a bioinformatic toolfor the selection of appropriate guide RNAs from E.coli ribosomal 16S RNA that adhered to the following rules:

- The 3' end of the DNA target sequence must have a proto-spacer adjacent motif (PAM) sequence (5'-NGG-3').

- The 20 nucleotides upstream of the PAM sequence will be your targeting sequence (crRNA) and Cas9 nuclease will cleave approximately 3 bases upstream of the PAM.

- The PAM sequence itself is absolutely required for cleavage, but it is NOT part of the sgRNA sequence and therefore should not be included in the sgRNA.

- The target sequence can be on either DNA strand.

From this programwe identified the the following 'R1' guide sequence: GGTGGGGTAACGGCTCACCA

This guide sequence was added to the conserved DNA scaffold sequence that will interact with bacterial Cas9: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT

This was synthesised by IDT gBlock as a single fragment together with the biobrick Prefix and Suffix and directly cloned into pSB1C3 using EcoRI and PstI.

Source

E.coli 16S ribosomal RNA

References