Difference between revisions of "Part:BBa K1875014"

Line 5: Line 5:
 
   
 
   
  
The BostonU 2016 iGEM team set out to design a set of mutually orthogonal guide RNA (gRNA) expressing and guide RNA operator pairs that could activate the expression of a gene of interest. This part contains target sequence for g3 from BostonU’s Gemini Library (AATGAACCTATTCGTACCGT).As figure 2 indicates, the introduction of the gRNA leads to a several fold increase in expression in comparison to the basal level without the gRNA. The matrix, figure 3, illustrates the results from a mutual orthogonality screen showing on target and off target expression levels among the guide expression vectors and the guide operator vectors in our system . The results from this experiment show that there is no significant expression among off target pairs, demonstrating that there is no cross talk in Gemini.
+
The 2016 BostonU iGEM team designed a set of mutually orthogonal guide RNA (gRNA) expression vectors and gRNA operator reporters that could activate the expression of a gene of interest. This part contains the gRNA operator target sequence for gRNA 3 from BostonU’s Gemini Library (5’-TCTGCCCGAAGTTTCGACGG-3’) (Part BBa_K1875005). The introduction of the gRNA leads to a significant fold increase in expression of the gene of interest in comparison to the basal level tested without the gRNA (figure 2). Figure 3 illustrates the results from a mutual orthogonality screen showing on target and off target expression levels among the guide expression vectors and the gRNA operator reporters in the Gemini Library. These results show that there is no significant expression among off target gRNA and operator pairs, demonstrating that there is no cross talk in Gemini. The Gemini system was compared to a CMV from the registry (Part BBa_I712004) to test its strength against a different promoter.  This operator reporter was found to be stronger than the CMV; however, also from the Gemini Library, the gRNA 3 triple multimerized operator reporter was found to have much more significant stronger expression than the CMV
 +
 
  
 
[[File:T--BostonU--pGOP_circle_map.png|400px|thumb|left|Figure 1: gRNA operator reporter plasmid map]]
 
[[File:T--BostonU--pGOP_circle_map.png|400px|thumb|left|Figure 1: gRNA operator reporter plasmid map]]
Line 12: Line 13:
 
<br>
 
<br>
 
[[File:T--BostonU--Mutual_orthog.png|400px|thumb|left|Figure 3: Mutual Orthogonality among gRNA expression vectors and gRNA operator reporters in Gemini. The green diagonal down the matrix indicates that there is no significant off target gene expression.  Measured in arbitrary median fluorescence intensity.]]
 
[[File:T--BostonU--Mutual_orthog.png|400px|thumb|left|Figure 3: Mutual Orthogonality among gRNA expression vectors and gRNA operator reporters in Gemini. The green diagonal down the matrix indicates that there is no significant off target gene expression.  Measured in arbitrary median fluorescence intensity.]]
 +
 +
[[File:T--BostonU--ProjectDescription.png|400px|thumb|center|[http://2016.igem.org/Team:BostonU BostonU 2016] Project description]][[File:T--BostonU--Bba I712004 Validation Part2.png|400px|thumb|center|[https://parts.igem.org/Part:BBa_I712004 CMV] vs Gemini operators]]
  
  

Revision as of 00:31, 19 October 2016

This operator, when paired with a guide RNA, expresses GFP.

Single Operator


The 2016 BostonU iGEM team designed a set of mutually orthogonal guide RNA (gRNA) expression vectors and gRNA operator reporters that could activate the expression of a gene of interest. This part contains the gRNA operator target sequence for gRNA 3 from BostonU’s Gemini Library (5’-TCTGCCCGAAGTTTCGACGG-3’) (Part BBa_K1875005). The introduction of the gRNA leads to a significant fold increase in expression of the gene of interest in comparison to the basal level tested without the gRNA (figure 2). Figure 3 illustrates the results from a mutual orthogonality screen showing on target and off target expression levels among the guide expression vectors and the gRNA operator reporters in the Gemini Library. These results show that there is no significant expression among off target gRNA and operator pairs, demonstrating that there is no cross talk in Gemini. The Gemini system was compared to a CMV from the registry (Part BBa_I712004) to test its strength against a different promoter. This operator reporter was found to be stronger than the CMV; however, also from the Gemini Library, the gRNA 3 triple multimerized operator reporter was found to have much more significant stronger expression than the CMV


Figure 1: gRNA operator reporter plasmid map
Figure 2: Screen of GFP expression in gRNA operator reporters with and without gRNA expression vectors


Figure 3: Mutual Orthogonality among gRNA expression vectors and gRNA operator reporters in Gemini. The green diagonal down the matrix indicates that there is no significant off target gene expression. Measured in arbitrary median fluorescence intensity.
[http://2016.igem.org/Team:BostonU BostonU 2016] Project description
CMV vs Gemini operators






















Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 927
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]