Difference between revisions of "Part:BBa K1875012"

 
(2 intermediate revisions by 2 users not shown)
Line 2: Line 2:
 
<partinfo>BBa_K1875012 short</partinfo>
 
<partinfo>BBa_K1875012 short</partinfo>
  
This part can be used to express a guide RNA (g8) from BostonU 2016’s project Gemini. Specifically, this part expresses g8, a guide RNA that directly recognizes the 20bp target sequence 5’ GTTGCGCGTCCGTATCAAGG 3’. This 20bp target sequence can be found in composite part BBa_K1875004.  
+
This basic part can be used to express a guide RNA (gRNA) from [http://2016.igem.org/Team:BostonU BostonU 2016’s project Gemini]. Specifically, this part expresses gRNA 8, the 20bp target sequence 5’-GTTGCGCGTCCGTATCAAGG-3’. This sequence can be found in basic part [https://parts.igem.org/Part:BBa_K1875006 BBa_K1875006] and composite part [https://parts.igem.org/Part:BBa_K1875015 BBa_K1875015], an operator reporter from the Gemini Library.  
  
We used transient transfection into HEK293FT cells to validate functionality of this part. We co-delivered a plasmid with BBa_K1875001 (this composite part with g8), a plasmid with BBa_K1875004 (the corresponding GFP reporter composite part with g8’s target sequence), and a plasmid expressing dCas9-VPR. We assayed for fluorescence of GFP using flow cytometry. We compared expression levels of GFP both with and without the guide RNA. Our results indicate that there is a low level of expression without g8 and a high level of expression with g8.
+
gRNA expression vectors were transiently transfected into HEK293FT cells with guide  to validate the functionality of this part. These vectors were co-transfected with dCas9-VPR and its paired gRNA operator reporters containing gRNA 8, a mini CMV ([https://parts.igem.org/Part:BBa_K1875000 BBa_K1875000]), a Kozak ([https://parts.igem.org/Part:BBa_K1875001 BBa_K1875001]), a GFP ([https://parts.igem.org/Part:BBa_K1875003 BBa_K1875003]), and a rabbit beta globin poly-A terminator ([https://parts.igem.org/Part:BBa_K1875002 BBa_K1875002]).  GFP fluorescence was assayed using flow cytometry to compare expression levels both with and without the gRNA expression vectors. Results indicated that there was low basal expression without gRNA 8 and a high level of expression with gRNA 8. The Gemini system was compared to a CMV from the registry (Part [https://parts.igem.org/Part:BBa_I712004 BBa_I712004]) to test its strength against a different promoter.  The parts containing gRNA 8 from the Gemini system were found to be stronger than the CMV.
  
 
[[File:T--BostonU--pGEX_circle_map.png|400px|thumb|left|gRNA expression vector plasmid map]][[File:T--BostonU--chosen_four_GFP.png|400px|thumb|center|Screen of GFP expression in gRNA operator reporters with and without gRNA expression vectors]]
 
[[File:T--BostonU--pGEX_circle_map.png|400px|thumb|left|gRNA expression vector plasmid map]][[File:T--BostonU--chosen_four_GFP.png|400px|thumb|center|Screen of GFP expression in gRNA operator reporters with and without gRNA expression vectors]]
 +
 +
[[File:T--BostonU--ProjectDescription.png|400px|thumb|left|Description of dCas9-VPR activity]][[File:T--BostonU--Bba I712004 Validation Part2.png|400px|thumb|center|[https://parts.igem.org/Part:BBa_I712004 CMV] vs Gemini operators]]
 +
 +
 +
  
  

Latest revision as of 00:23, 19 October 2016

This part produces a guide RNA that pairs with an operator.

This basic part can be used to express a guide RNA (gRNA) from [http://2016.igem.org/Team:BostonU BostonU 2016’s project Gemini]. Specifically, this part expresses gRNA 8, the 20bp target sequence 5’-GTTGCGCGTCCGTATCAAGG-3’. This sequence can be found in basic part BBa_K1875006 and composite part BBa_K1875015, an operator reporter from the Gemini Library.

gRNA expression vectors were transiently transfected into HEK293FT cells with guide to validate the functionality of this part. These vectors were co-transfected with dCas9-VPR and its paired gRNA operator reporters containing gRNA 8, a mini CMV (BBa_K1875000), a Kozak (BBa_K1875001), a GFP (BBa_K1875003), and a rabbit beta globin poly-A terminator (BBa_K1875002). GFP fluorescence was assayed using flow cytometry to compare expression levels both with and without the gRNA expression vectors. Results indicated that there was low basal expression without gRNA 8 and a high level of expression with gRNA 8. The Gemini system was compared to a CMV from the registry (Part BBa_I712004) to test its strength against a different promoter. The parts containing gRNA 8 from the Gemini system were found to be stronger than the CMV.

gRNA expression vector plasmid map
Screen of GFP expression in gRNA operator reporters with and without gRNA expression vectors
Description of dCas9-VPR activity
CMV vs Gemini operators







Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal AgeI site found at 247
  • 1000
    COMPATIBLE WITH RFC[1000]