Difference between revisions of "Part:BBa K2075007:Design"

 
(Design Notes)
 
Line 7: Line 7:
  
 
===Design Notes===
 
===Design Notes===
No consideration.
+
This composite part includes an Intein and linker, the TAL-effector Ax7R-RR, a TEV Site and a Strep Tag. They translated all together. The intein and linker are important to circularice the aminoacid sequence between the N- and C-terminal parts. Between the Intein sites is the TAL-effector and the TEV Site. There is also a strep II tag. When it is translated the intein sites react and form a circularised protein. All the parts between N- and C-Terminal Intein is part of the protein circle. In this circle the hole protein gains more stability. With the help of the strep II tag the protein can be purified even if it is circularised. The Strep II Tag is also usefull to detect the protein with an immunostain. The TEV Site give the opportunity to linearise the protein again wit the help oft he TEV protease. The linearised TAL can bind the specific DNA Sequence. The 12th and 13th amino acid of each of the repeats from our Ax7R-RR are: NG NN NI NI NN NN HD NG NG NN NI NG NN NI NN HD NG They bind the DNA sequence: T G/A A A G/A G/A C T T G/A A T G/A A G/A C T
 
+
 
+
  
 
===Source===
 
===Source===

Latest revision as of 19:33, 18 October 2016


Vector iGem_02 Ax7R- RR


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 3109
    Illegal BamHI site found at 2515
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 2454
    Illegal NgoMIV site found at 3049
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 2529


Design Notes

This composite part includes an Intein and linker, the TAL-effector Ax7R-RR, a TEV Site and a Strep Tag. They translated all together. The intein and linker are important to circularice the aminoacid sequence between the N- and C-terminal parts. Between the Intein sites is the TAL-effector and the TEV Site. There is also a strep II tag. When it is translated the intein sites react and form a circularised protein. All the parts between N- and C-Terminal Intein is part of the protein circle. In this circle the hole protein gains more stability. With the help of the strep II tag the protein can be purified even if it is circularised. The Strep II Tag is also usefull to detect the protein with an immunostain. The TEV Site give the opportunity to linearise the protein again wit the help oft he TEV protease. The linearised TAL can bind the specific DNA Sequence. The 12th and 13th amino acid of each of the repeats from our Ax7R-RR are: NG NN NI NI NN NN HD NG NG NN NI NG NN NI NN HD NG They bind the DNA sequence: T G/A A A G/A G/A C T T G/A A T G/A A G/A C T

Source

tatgtacccatacgatgttcctgactatgcggccaagaagaagaggaaggtgcaggtggatctacgcacgctcggctacagccagcagcaacaggagaagatcaaaccgaaggttcgttcgacagtggcgcagcaccacgaggcactggtcggccatgggtttacacacgcgcacatcgttgcgctcagccaacacccggcagcgttagggaccgtcgctgtcaagtatcaggacatgatcgcagcgttgccagaggcgacacacgaagcgatcgttggcgtcggcaaacagtggtccggcgcacgcgctctggaggccttgctcacggtggcgggagagttgagaggtccaccgttacagttggacacaggccaacttctcaagattgcaaagcgtggcggcgtgaccgcagtggaggcagtgcatgcatggcgcaatgcactgacgggtgcccccctgaaccttaccccggagcaggtggtggccatcgccagcaatggcggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaataacggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgacaccggagcaggtggtggccatcgccagcaatattggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctcaccccggagcaggtggtggccatcgccagcaatattggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgactccggagcaggtggtggccatcgccagcaataacggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaataacggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcgcatggccttaccccggagcaggtggtggccatcgccagccacgatggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaatggcggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgacaccggagcaggtggtggccatcgccagcaatggcggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctcaccccggagcaggtggtggccatcgccagcaataacggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgactccggagcaggtggtggccatcgccagcaatattggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaatggcggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcgcatggccttaccccggagcaggtggtggccatcgccagcaataacggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaatattggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgacaccggagcaggtggtggccatcgccagcaataacggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctcaccccggagcaggtggtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgactccggagcaggtggtggccatcgccagcaatggcggcggcaagcaggcgctggagagcattgttgcccagttatctcgccctgatccgtcgttggccgcgttaaccaacgaccacctcgtcgccttggcctgcctcggcggacgtcctgcgctggatgcagtgaaaaagggattgccgcacgcgccggccttgatcaaaagaaccaatcgccgtattcccgaacgcacatcccatcgcgttgccggatcccagctggtgaagagcgagctggaggagaagaagtccgagctgcggcacaagctgaagtacgtgccccacgagtacatcgagctgatcgagatcgccaggaaccccacccaggaccgcatcctggagatgaaggtgatggagttcttcatgaaggtgtacggctacaggggagagcacctgggcggaagcagaaagcctgacggcgccatctatacagtgggcagccccatcgattacggcgtgatcgtggacacaaaggcctacagcggcggctacaatctgcctatcggccaggccagagagatgcagagatacgtggaggagaaccagacccggaataagcacatcaaccccaacgagtggtggaaggtgtaccctagcagcgtgaccgagttcaagttcctgttcgtgagcggccacttcaagggcaactacaaggcccagctgaccaggctgaaccacatcaccaactgcaatggcgccgtgctgagcgtggaggagctgctgatcggcggcgagatgatcaaagccggcaccctgacactggaggaggtgcggcgcaagttcaacaacggcgagatcaac

References