Difference between revisions of "Part:BBa K2060000:Design"
(→Design Notes) |
|||
Line 8: | Line 8: | ||
===Design Notes=== | ===Design Notes=== | ||
One of the Cardiff_Wales iGEM instructors Daniel Pass, designed a [https://github.com/passdan/scriptdrop/blob/master/cas9_targeter.py bioinformatic tool] for the selection of appropriate guide RNAs that adhered to the following rules: | One of the Cardiff_Wales iGEM instructors Daniel Pass, designed a [https://github.com/passdan/scriptdrop/blob/master/cas9_targeter.py bioinformatic tool] for the selection of appropriate guide RNAs that adhered to the following rules: | ||
− | Use the following guidelines to select a genomic DNA region that corresponds to the crRNA sequence of the sgRNA: | + | <p>Use the following guidelines to select a genomic DNA region that corresponds to the crRNA sequence of the sgRNA: |
− | + | <p> - The 3' end of the DNA target sequence must have a proto-spacer adjacent motif (PAM) sequence (5'-NGG-3'). | |
- The 20 nucleotides upstream of the PAM sequence will be your targeting sequence (crRNA) and Cas9 nuclease will cleave approximately 3 bases upstream of the PAM. | - The 20 nucleotides upstream of the PAM sequence will be your targeting sequence (crRNA) and Cas9 nuclease will cleave approximately 3 bases upstream of the PAM. | ||
- The PAM sequence itself is absolutely required for cleavage, but it is NOT part of the sgRNA sequence and therefore should not be included in the sgRNA. | - The PAM sequence itself is absolutely required for cleavage, but it is NOT part of the sgRNA sequence and therefore should not be included in the sgRNA. | ||
Line 24: | Line 24: | ||
Used standard design considerations for guide RNAs | Used standard design considerations for guide RNAs | ||
− | |||
− | |||
===Source=== | ===Source=== |
Revision as of 14:57, 17 October 2016
CRISPR-Cas9 guide RNA targeting to 16S RNA
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal AgeI site found at 48
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
One of the Cardiff_Wales iGEM instructors Daniel Pass, designed a bioinformatic tool for the selection of appropriate guide RNAs that adhered to the following rules:
Use the following guidelines to select a genomic DNA region that corresponds to the crRNA sequence of the sgRNA: <p> - The 3' end of the DNA target sequence must have a proto-spacer adjacent motif (PAM) sequence (5'-NGG-3'). - The 20 nucleotides upstream of the PAM sequence will be your targeting sequence (crRNA) and Cas9 nuclease will cleave approximately 3 bases upstream of the PAM. - The PAM sequence itself is absolutely required for cleavage, but it is NOT part of the sgRNA sequence and therefore should not be included in the sgRNA. - The target sequence can be on either DNA strand. The sequence is below has the Forward guide sequence and the General Scaffold sequences highlighted. This was synthesised as a single fragment and we aimed to directly clone this fragment into pSB1C3 using EcoRI and PstI. However we were unable to identify a clone with the correct sequence. Therefore this aspect of the project will continue during future related research. GTCATCCTCTCAGACCAGCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT GGTGGGGTAACGGCTCACCA Used standard design considerations for guide RNAs
Source
E.coli 16S ribosomal RNA
===References===