Difference between revisions of "Part:BBa K1875019"

Revision as of 19:53, 16 October 2016

This operator, when paired with a guide RNA, expresses GFP.

Mutant Operator

The BostonU 2016 iGEM team’s Gemini Library contains analog parts in addition to their digital parts. They synthesized mutated binding sites to decrease the expression of the operator. This hypothesis was supported by previous research suggesting that a mutated operator reduces the binding affinity of the dCas9-VPR complex. They used two mutation techniques: sequential mutation of a single base in the guide, beginning at the 5’ end, and clustered mutations at either base 1 or base 11. The altered base was determined by whether the base was a purine or a pyrimidine and the complement of the base. If the base was a purine, it was mutated to be a pyrimidine and of the opposite coupled nucleotide (i.e: A <-->C, G<-->T). Figure 2 demonstrates a screen with this mutated operator containing g13 from the Gemini Library (guide sequence: GTTCTAAACGTTGGTCCGTC). BostonU 2016 chose to submit the mutant operator with mutations at base 10 resulting in a sequence of GTTCTAAACTTTGGTCCGTC. The motivation behind this choice was the near five fold decrease in expression in comparison to the non-mutated operator.

Figure 1: gRNA operator reporter plasmid map

Figure 2: Screen of GFP expression in mutated operator reporter (containing g13) with and without the gRNA expression vector

Sequence and Features