Difference between revisions of "Part:BBa K1875013"

Revision as of 19:17, 16 October 2016

This operator, when paired with a guide RNA, expresses GFP

Single Operator

The BostonU 2016 iGEM team set out to design a set of mutually orthogonal guide RNA (gRNA) expressing and guide RNA operator pairs that could activate the expression of a gene of interest. This part contains target sequence for g1 from BostonU’s Gemini Library (TCTGCCCGAAGTTTCGACGG). As figure 2 indicates, the introduction of the gRNA leads to a several fold increase in expression in comparison to the basal level without the gRNA. The matrix (figure 3) illustrates the results from a mutual orthogonality screen showing on target and off target expression levels among the guide expression vectors and the guide operator vectors in our system . The results from this experiment show that there is no significant expression among off target pairs, demonstrating that there is no cross talk in Gemini.

Figure 1: gRNA operator reporter plasmid map

Figure 2: Screen of GFP expression in gRNA operator reporters with and without gRNA expression vectors

Figure 3: Mutual Orthogonality among gRNA expression vectors and gRNA operator reporters in Gemini. The green diagonal down the matrix indicates that there is no significant off target gene expression. Measured in arbitrary median fluorescence intensity.

Sequence and Features