Difference between revisions of "Part:BBa K1875012"
| Line 5: | Line 5: | ||
We used transient transfection into HEK293FT cells to validate functionality of this part. We co-delivered a plasmid with BBa_K1875001 (this composite part with g8), a plasmid with BBa_K1875004 (the corresponding GFP reporter composite part with g8’s target sequence), and a plasmid expressing dCas9-VPR. We assayed for fluorescence of GFP using flow cytometry. We compared expression levels of GFP both with and without the guide RNA. Our results indicate that there is a low level of expression without g8 and a high level of expression with g8. | We used transient transfection into HEK293FT cells to validate functionality of this part. We co-delivered a plasmid with BBa_K1875001 (this composite part with g8), a plasmid with BBa_K1875004 (the corresponding GFP reporter composite part with g8’s target sequence), and a plasmid expressing dCas9-VPR. We assayed for fluorescence of GFP using flow cytometry. We compared expression levels of GFP both with and without the guide RNA. Our results indicate that there is a low level of expression without g8 and a high level of expression with g8. | ||
| + | |||
| + | [[File:T--BostonU--pGEX_circle_map.png|400px|thumb|left|gRNA expression vector plasmid map]][[File:T--BostonU--chosen_four_GFP.png|400px|thumb|center|Screen of GFP expression in gRNA operator reporters with and without gRNA expression vectors]] | ||
| + | |||
<!-- Add more about the biology of this part here | <!-- Add more about the biology of this part here | ||
===Usage and Biology=== | ===Usage and Biology=== | ||
Revision as of 19:02, 16 October 2016
This part produces a guide RNA that pairs with an operator.
This part can be used to express a guide RNA (g8) from BostonU 2016’s project Gemini. Specifically, this part expresses g8, a guide RNA that directly recognizes the 20bp target sequence 5’ GTTGCGCGTCCGTATCAAGG 3’. This 20bp target sequence can be found in composite part BBa_K1875004.
We used transient transfection into HEK293FT cells to validate functionality of this part. We co-delivered a plasmid with BBa_K1875001 (this composite part with g8), a plasmid with BBa_K1875004 (the corresponding GFP reporter composite part with g8’s target sequence), and a plasmid expressing dCas9-VPR. We assayed for fluorescence of GFP using flow cytometry. We compared expression levels of GFP both with and without the guide RNA. Our results indicate that there is a low level of expression without g8 and a high level of expression with g8.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal AgeI site found at 247
- 1000COMPATIBLE WITH RFC[1000]