Difference between revisions of "Part:BBa K1875011"

Revision as of 18:56, 16 October 2016

This part produces a guide RNA that pairs with an operator.

Guide RNA g3 Expression Part

This part can be used to express a guide RNA (gRNA) from BostonU 2016’s project Gemini. Specifically, this part expresses g3, a gRNA that directly recognizes the 20bp target sequence 5’ AATGAACCTATTCGTACCGT 3’. This sequence can be found in basic part BBa_K1875003.

We used transient transfection into HEK293FT cells to validate functionality of this part. We co-delivered a plasmid containing a minimal CMV (Part BBa_K1875000), a variant of the g3 sequence, and a GFP reporter (Part BBa_K1875003) and a plasmid expressing dCas9-VPR. We assayed for fluorescence of GFP using flow cytometry. We compared expression levels of GFP both with and without the gRNA. Our results indicate that there is a low level of expression without g3 and a high level of expression with g3.

gRNA expression vector plasmid map

Sequence and Features