Difference between revisions of "Part:BBa K2040100:Experience"

Line 1: Line 1:
  
 
__NOTOC__
 
__NOTOC__
This experience page is provided so that any user may enter their experience using this part.<BR>Please enter
+
 
how you used this part and how it worked out.
+
  
 
===Applications of BBa_K2040100===
 
===Applications of BBa_K2040100===
We used primer  
+
We used  
 +
forward primer  
 
5' ACGTCCTGCAGAATCATGCAGCGCTATGAG 3'
 
5' ACGTCCTGCAGAATCATGCAGCGCTATGAG 3'
 +
& reverse primer
 
5' ATAAGCGGCCGCCATGATGGTCTAGGGAACG 3'  
 
5' ATAAGCGGCCGCCATGATGGTCTAGGGAACG 3'  
to amplify PMcl1 and XXbp 5' untranslated region downstream the promoter from genomic DNA of ''Metarhizium anisopliae''.
+
to extract PMcl1 and its 5' untranslated region (99bp downstream the promoter) from genomic DNA of ''Metarhizium anisopliae''. The whole length is 2772bp.
 +
 
 +
[[Image:PMcl1_PCR.png|left|250px|thumb|Figure1. Amplify PMcl1 from gDNA]]
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
 +
Then we digested the DNA fragment with NotI and PstI in order to insert it into the backbone. However, when we ran gel electrophoresis to check the digestion result, we found that there is still one PstI restriction site inside the PMcl1 whcih is the one we did not know when we designed.
 +
 
 +
 
 +
 
 +
 
 +
 
 +
 
  
[]
 
  
 
===User Reviews===
 
===User Reviews===

Revision as of 07:42, 16 October 2016



Applications of BBa_K2040100

We used forward primer 5' ACGTCCTGCAGAATCATGCAGCGCTATGAG 3' & reverse primer 5' ATAAGCGGCCGCCATGATGGTCTAGGGAACG 3' to extract PMcl1 and its 5' untranslated region (99bp downstream the promoter) from genomic DNA of Metarhizium anisopliae. The whole length is 2772bp.

Figure1. Amplify PMcl1 from gDNA


















Then we digested the DNA fragment with NotI and PstI in order to insert it into the backbone. However, when we ran gel electrophoresis to check the digestion result, we found that there is still one PstI restriction site inside the PMcl1 whcih is the one we did not know when we designed.





User Reviews

UNIQ7835ed525ad8d895-partinfo-00000000-QINU UNIQ7835ed525ad8d895-partinfo-00000001-QINU