Difference between revisions of "Part:BBa K1875011"
| Line 5: | Line 5: | ||
Guide RNA g3 Expression Part | Guide RNA g3 Expression Part | ||
| − | This | + | This part can be used to express a guide RNA (g3) from BostonU 2016’s project Gemini. Specifically, this part expresses g3, a guide RNA that directly recognizes the 20bp target sequence 5’ AATGAACCTATTCGTACCGT 3’. This 20bp target sequence can be found in composite part BBa_K1875003. |
We used transient transfection into HEK293FT cells to validate functionality of this part. We co-delivered a plasmid with BBa_K1875000 (this composite part with g3), a plasmid with BBa_K1875003 (the corresponding GFP reporter composite part with g3’s target sequence), and a plasmid expressing dCas9-VPR. We assayed for fluorescence of GFP using flow cytometry. We compared expression levels of GFP both with and without the guide RNA. Our results indicate that there is a low level of expression without g3 and a high level of expression with g3. | We used transient transfection into HEK293FT cells to validate functionality of this part. We co-delivered a plasmid with BBa_K1875000 (this composite part with g3), a plasmid with BBa_K1875003 (the corresponding GFP reporter composite part with g3’s target sequence), and a plasmid expressing dCas9-VPR. We assayed for fluorescence of GFP using flow cytometry. We compared expression levels of GFP both with and without the guide RNA. Our results indicate that there is a low level of expression without g3 and a high level of expression with g3. | ||
Revision as of 17:42, 15 October 2016
This part produces a guide RNA that pairs with an operator.
Guide RNA g3 Expression Part
This part can be used to express a guide RNA (g3) from BostonU 2016’s project Gemini. Specifically, this part expresses g3, a guide RNA that directly recognizes the 20bp target sequence 5’ AATGAACCTATTCGTACCGT 3’. This 20bp target sequence can be found in composite part BBa_K1875003.
We used transient transfection into HEK293FT cells to validate functionality of this part. We co-delivered a plasmid with BBa_K1875000 (this composite part with g3), a plasmid with BBa_K1875003 (the corresponding GFP reporter composite part with g3’s target sequence), and a plasmid expressing dCas9-VPR. We assayed for fluorescence of GFP using flow cytometry. We compared expression levels of GFP both with and without the guide RNA. Our results indicate that there is a low level of expression without g3 and a high level of expression with g3.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]