Difference between revisions of "Part:BBa K2012009"
Line 3: Line 3:
 
<partinfo>BBa_K2012009 short</partinfo>
 
<partinfo>BBa_K2012009 short</partinfo>
  
−
Bacteria movement related gene CheZ which fused with a GS linker and GFP in C teminal. We will use this part to charactise the expression of CheZ. These parts are present in plasmid pSB1C3, but there is also a constitutive promoter(J23100-derived)
+
<div>&nbsp;<span style="color:rgb(40, 40, 40);font-family:arial, sans-serif;font-size:13px">These parts are present in plasmid pSB1A2, but there is also a constitutive promoter (J23100-derived) inserted into the XbaI site. So, for example, the EcoRI/PstI region of part J61100 reads:</span><br/>
−
So, for example, the EcoRI/PstI region of part K2012009 reads:
+
</div>
−
[[----Biobrick5' XbaI J23100 XbaI '''K2012009''' Biobrick 3' <br/>
+
<span>--------------------------------------------------------------------------------------------------------------------------------------------------------------------</span><br/>
−
gaattcgcggccgcttctagaGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTtctaga'''sequence part...'''actagtagcggccgctgcag |----- .]]
+
Biobrick 5' &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;&nbsp; XbaI &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;J23100 &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;&nbsp; XbaI &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; <span style="font-weight:bold">&nbsp; K2012009&nbsp; &nbsp; &nbsp; &nbsp;</span> &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;&nbsp;Biobrick 3' <br/>
 +
gaattcgcggccgcttctagaGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTtctaga<b><span style="font-weight:normal">...................................</span></b><span>actagtagcggccgctgcag</span>
 +
<div>---------------------------------------------------------------------------------------------------------------------------------------------------------------------&nbsp;</div>
 +
<p style="margin-top:0.4em;margin-bottom:0.5em;color:rgb(40, 40, 40);font-family:arial, sans-serif;font-size:13px">This feature in no way prevents the use of these parts in standard Biobrick assembly. Normal prefix insertion into EcoRI/XbaI will delete this promoter element. Suffix insertion into SpeI/PstI will retain this promoter, but it can of course be removed later by a prefix insertion.</p>
 +
<p style="margin-top:0.4em;margin-bottom:0.5em;color:rgb(40, 40, 40);font-family:arial, sans-serif;font-size:13px">Note also that the base 5' to the SpeI site is allowed to float in these parts and is therefore rarely "T". The "G" downstream of the XbaI site obeys the standard. Because the database does not permit variation at this position, the predicted sequences of composite parts derived from these parts will be incorrect at this position.</p>
 
<html>
 
<html>
  

Revision as of 15:23, 15 October 2016


RBS(J61100) and CheZ with fused with a GS linker and GFP in C teminal

 These parts are present in plasmid pSB1A2, but there is also a constitutive promoter (J23100-derived) inserted into the XbaI site. So, for example, the EcoRI/PstI region of part J61100 reads:
--------------------------------------------------------------------------------------------------------------------------------------------------------------------

Biobrick 5'            XbaI                                            J23100                                    XbaI             K2012009                      Biobrick 3'
gaattcgcggccgcttctagaGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTtctaga...................................actagtagcggccgctgcag

--------------------------------------------------------------------------------------------------------------------------------------------------------------------- 

This feature in no way prevents the use of these parts in standard Biobrick assembly. Normal prefix insertion into EcoRI/XbaI will delete this promoter element. Suffix insertion into SpeI/PstI will retain this promoter, but it can of course be removed later by a prefix insertion.

Note also that the base 5' to the SpeI site is allowed to float in these parts and is therefore rarely "T". The "G" downstream of the XbaI site obeys the standard. Because the database does not permit variation at this position, the predicted sequences of composite parts derived from these parts will be incorrect at this position.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 1321