Difference between revisions of "Part:BBa K2012009"
Line 3: | Line 3: | ||
<partinfo>BBa_K2012009 short</partinfo> | <partinfo>BBa_K2012009 short</partinfo> | ||
− | + | <div> <span style="color:rgb(40, 40, 40);font-family:arial, sans-serif;font-size:13px">These parts are present in plasmid pSB1A2, but there is also a constitutive promoter (J23100-derived) inserted into the XbaI site. So, for example, the EcoRI/PstI region of part J61100 reads:</span><br/> | |
− | So, for example, the EcoRI/PstI region of part | + | </div> |
− | + | <span>--------------------------------------------------------------------------------------------------------------------------------------------------------------------</span><br/> | |
− | gaattcgcggccgcttctagaGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTtctaga | + | Biobrick 5' XbaI J23100 XbaI <span style="font-weight:bold"> K2012009 </span> Biobrick 3' <br/> |
+ | gaattcgcggccgcttctagaGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTtctaga<b><span style="font-weight:normal">...................................</span></b><span>actagtagcggccgctgcag</span> | ||
+ | <div>--------------------------------------------------------------------------------------------------------------------------------------------------------------------- </div> | ||
+ | <p style="margin-top:0.4em;margin-bottom:0.5em;color:rgb(40, 40, 40);font-family:arial, sans-serif;font-size:13px">This feature in no way prevents the use of these parts in standard Biobrick assembly. Normal prefix insertion into EcoRI/XbaI will delete this promoter element. Suffix insertion into SpeI/PstI will retain this promoter, but it can of course be removed later by a prefix insertion.</p> | ||
+ | <p style="margin-top:0.4em;margin-bottom:0.5em;color:rgb(40, 40, 40);font-family:arial, sans-serif;font-size:13px">Note also that the base 5' to the SpeI site is allowed to float in these parts and is therefore rarely "T". The "G" downstream of the XbaI site obeys the standard. Because the database does not permit variation at this position, the predicted sequences of composite parts derived from these parts will be incorrect at this position.</p> | ||
<html> | <html> | ||
Revision as of 15:23, 15 October 2016
RBS(J61100) and CheZ with fused with a GS linker and GFP in C teminal
--------------------------------------------------------------------------------------------------------------------------------------------------------------------
Biobrick 5' XbaI J23100 XbaI K2012009 Biobrick 3'
gaattcgcggccgcttctagaGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTtctaga...................................actagtagcggccgctgcag
This feature in no way prevents the use of these parts in standard Biobrick assembly. Normal prefix insertion into EcoRI/XbaI will delete this promoter element. Suffix insertion into SpeI/PstI will retain this promoter, but it can of course be removed later by a prefix insertion.
Note also that the base 5' to the SpeI site is allowed to float in these parts and is therefore rarely "T". The "G" downstream of the XbaI site obeys the standard. Because the database does not permit variation at this position, the predicted sequences of composite parts derived from these parts will be incorrect at this position.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 1321