Latest revision as of 09:28, 15 October 2016

pSB_Bs0K-P_spac (replicative Bacillus subtilis expression vector; IPTG inducible

This part is an expression vector for Bacillus subtilis. It is replicative both in E.coli and B.subtilis. It has an ampicillin resistance for cloning in E.coli and kanamycin resistance for selection in B. subtilis. The multiple cloning site is downstream of a P_spac promoter, that is inducible with IPTG (Isopropyl-β-D-thiogalactopyranosid).

This backbone is a BioBricked version of the B. subtilis overexpression vector pDG148. Reference: [http://www.ncbi.nlm.nih.gov/pubmed/11728721 Joseph et al.]

For handling of B. subtilis vectors, please see here.

The transformation into B. subtilis is explained here.

CAUTION: THIS VECTOR DOES NOT WORK AS EXPECTED! THE PROMOTER IS STRONG CONSTITUTIVE INSTEAD OF IPTG-INDUCIBLE!

pSB_Bs0K-P_spac is a replicative expression vector with a kanamycin resistance. The IPTG (isopropylbeta-D-thiogalactopyranoside)-inducible Promoter P_spac is followed by the multiple cloning site and a terminator. Also expressed are lacY, a transporter for IPTG (naturally allolactose), and lac, the repressor. In presence of IPTG, LacI releases from the promoter and the gene of interest is expressed.

The ble gene encodes the bleomycin resisitance protein (BRP) which can be selected for by bleomycine or phleomycin in E. coli and B. subtilis. We did not use this resistance.

The presence of the vector can be checked for via colony PCR with the primers: CTACATCCAGAACAACCTCTGC and TTCGGAAGGAAATGATGACCTC. We did not perfom the colony PCR because we selected for functionality on plates with X-Gal and IPTG and we got blue colonies.

lacZ-activity in Miller units in pSBBs0K-Pspac depending on B. subtilis growth phase.

This expression vector was tested by insertion of lacZ into the multiple cloning site, transformation into W168 and ONPG assays. Overnight cultures were diluted 1:100 in LB-medium and incubated at 37°C, 230 rpm. Cells were harvested in 2 ml reaction tubes and frozen. For the induction assay, at an OD₆₀₀ around 0.9 were split into 3 ml aliquots in test tubes with the given IPTG-concentrations and incubated for another hour. Data for splitting at OD₆₀₀ around 0.3 is not shown, but similar.

lacZ-activity in Miller units in pSBBs0K-Pspac depending on IPTG concentrations.

In summary, the figures show that the expression is very strong, even without induction [in comparison to the native B. subtilis promoters] and does not change with IPTG addition. It does change depending on the growth phase, with a maximum strength in the stationary phase.

This vector was designed for overexpression of proteins, but is not inducible but constitutively active.

This BioBrick is part of the LMU 2012 igem project [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks BacillusBioBrickBox]

Note from iGEM Toulouse 2016:

This plasmid is the only replicative plasmid for Bacillus subtilis in the registry. As so, this BioBrick was improved by the iGEM Toulouse 2016 team by reducing its size down to 5827pb (compared to the 9358pb of the entire pSBBsOK -P). This makes clonings a lot more convenient. This new version is available at https://parts.igem.org/Part:BBa_K1937001. It is also described at http://2016.igem.org/Team:Toulouse_France/Description

Note that iGEM Toulouse 2016 also improved this backbone by creating from it a part that could turn any pSB1C3-based plasmid in a E.coli/B.subtilis shuttle vector. This part is named OriKan and can be found at https://parts.igem.org/Part:BBa_K1937002. While Bacillus subtilis is of huge interest for a growing number of iGEM projects, it is not easy to develop new parts as it is required that they are registered after sub-cloning in the E. coli plasmid pSB1C3. In this context, the OriKAn part opens the whole iGEM registry to Bacillus-based projects. Its construction and validation are presented at http://2016.igem.org/Team:Toulouse_France/Description.

Sequence and Features