Difference between revisions of "Part:BBa K1927000:Design"

 
(→‎Design Notes)
 
(6 intermediate revisions by the same user not shown)
Line 7: Line 7:
  
 
===Design Notes===
 
===Design Notes===
−
We added prefix and suffix to the gene so that we could perform restriction digestion and Gibson Assembly. We had to design the gene so that it will get the correct readingframe.
 
  
  
 +
This particular gene belongs to class B which represent metallo-β-lacatamases that contain zink in the active site.
 +
We designed this biobrick without any promotor for safety reasons. As this enzyme may be resistant to several types of antibiotic the UiOslo team felt that it would be safer to design the biobrick without any promotor so that any team that wish to work with this part may use it in a controlled manner.
  
−
===Source===
+
The sequence was obtained from a clinical isolate collected from Norway and was sent to IDT for synthesizing. By designing special flanking regions the gene could easily be cloned into the shipping vector by Gibson Assembly.
 +
 +
These are the flanking regions the gene was designed with:
 +
Gctaaggatgatttctggaattcgcggccgcttctagatg<GENE>tactagtagcggccgctgcagtccggcaaaaaagggcaag
  
−
The sequence is collected from pUC19 vector online and sent for synthesis to IDT.  
+
If the part will be used in classical cloning with restriction enzymes be aware of the gene may naturally contain several restriction enzymes that may influence the experiment.
 +
 
 +
===Source===
 +
This part is originally from a clinical isolate of a ESBL E. Coli strain collected from a antibiotic resistance expertize center in Tromsø, Norway. The sequence has been sendt to IDT and synthesized.
  
 
===References===
 
===References===
 +
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1932750/
 +
http://www.sciencedirect.com/science/article/pii/S1319562X14000941#b0405

Latest revision as of 07:14, 14 October 2016


Beta-lacatamase enzyme called blaNDM-1


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI site found at 716


Design Notes

This particular gene belongs to class B which represent metallo-β-lacatamases that contain zink in the active site. We designed this biobrick without any promotor for safety reasons. As this enzyme may be resistant to several types of antibiotic the UiOslo team felt that it would be safer to design the biobrick without any promotor so that any team that wish to work with this part may use it in a controlled manner.

The sequence was obtained from a clinical isolate collected from Norway and was sent to IDT for synthesizing. By designing special flanking regions the gene could easily be cloned into the shipping vector by Gibson Assembly.

These are the flanking regions the gene was designed with: Gctaaggatgatttctggaattcgcggccgcttctagatg<GENE>tactagtagcggccgctgcagtccggcaaaaaagggcaag

If the part will be used in classical cloning with restriction enzymes be aware of the gene may naturally contain several restriction enzymes that may influence the experiment.

Source

This part is originally from a clinical isolate of a ESBL E. Coli strain collected from a antibiotic resistance expertize center in Tromsø, Norway. The sequence has been sendt to IDT and synthesized.

References

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1932750/ http://www.sciencedirect.com/science/article/pii/S1319562X14000941#b0405