Difference between revisions of "Part:BBa K1875013"
Line 1: | Line 1: | ||
+ | __NOTOC__ | ||
+ | <partinfo>BBa_K1875013 short</partinfo> | ||
+ | Single Operator | ||
+ | |||
+ | The BostonU 2016 iGEM team set out to design a set of mutually orthogonal guide RNA (gRNA) expressing and guide RNA operator pairs that could activate the expression of a gene of interest. This part contains target sequence for g1 from BostonU’s Gemini Library (TCTGCCCGAAGTTTCGACGG). As figure 1 indicates, the introduction of the gRNA leads to a several fold increase in expression in comparison to the basal level without the gRNA. The matrix, figure 2, illustrates the results from a mutual orthogonality screen showing on target and off target expression levels among the guide expression vectors and the guide operator vectors in our system . The results from this experiment show that there is no significant expression among off target pairs, demonstrating that there is no cross talk in Gemini. | ||
+ | |||
+ | <!-- Add more about the biology of this part here | ||
+ | ===Usage and Biology=== | ||
+ | |||
+ | <!-- --> | ||
+ | <span class='h3bb'>Sequence and Features</span> | ||
+ | <partinfo>BBa_K1875013 SequenceAndFeatures</partinfo> | ||
+ | |||
+ | |||
+ | <!-- Uncomment this to enable Functional Parameter display | ||
+ | ===Functional Parameters=== | ||
+ | <partinfo>BBa_K1875013 parameters</partinfo> | ||
+ | <!-- --> |
Revision as of 18:12, 12 October 2016
This operator, when paired with a guide RNA, expresses GFP
Single Operator
The BostonU 2016 iGEM team set out to design a set of mutually orthogonal guide RNA (gRNA) expressing and guide RNA operator pairs that could activate the expression of a gene of interest. This part contains target sequence for g1 from BostonU’s Gemini Library (TCTGCCCGAAGTTTCGACGG). As figure 1 indicates, the introduction of the gRNA leads to a several fold increase in expression in comparison to the basal level without the gRNA. The matrix, figure 2, illustrates the results from a mutual orthogonality screen showing on target and off target expression levels among the guide expression vectors and the guide operator vectors in our system . The results from this experiment show that there is no significant expression among off target pairs, demonstrating that there is no cross talk in Gemini.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 924
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]