Difference between revisions of "Part:BBa K1926003"
Line 31: | Line 31: | ||
G1 promoter function confirmation by transient transfection using 293T cells. Photos taken 48 hours after transient transfection, 10x. pCDK4, pKi67 and pCCNE are our G1 promoters. pmPGK is the constitutive promoter of mouse PGK, it is a medium promoter, here used as a control. | G1 promoter function confirmation by transient transfection using 293T cells. Photos taken 48 hours after transient transfection, 10x. pCDK4, pKi67 and pCCNE are our G1 promoters. pmPGK is the constitutive promoter of mouse PGK, it is a medium promoter, here used as a control. | ||
+ | [[Image:T--SYSU-CHINA--result-img.jpeg|800px|thumb|left|'''Figure 1:''' in vivo testing pG1 promoter function in human 293 cell line.]] | ||
+ | <br style="clear: both" /> | ||
Revision as of 05:54, 11 October 2016
A cyclic promoter of CDK4 from human genome
This part is a cyclic promoter named CDK4 from human genome. It can lead to transcription of the downstream DNA sequence in every G1 phase[1].
1. Guo, Z.Y., et al., The elements of human cyclin D1 promoter and regulation involved. Clin Epigenetics, 2011. 2(2): p. 63-76.
You may use this part to:
1) Express something in mammal cell lines particularly in G1 phases or once in every cell cycle by stable transfecting it into cell line;
2) Use it as a human promoter by transient transfecting it into cells.
Source:
The sequence was retrieved from Addgene. We got it from human genome through PCR using the following primers:
pCDK4-F: TGGTGGAGCGAAAAGGTGACAGCATC
pCDK4-R: GCGGAAACTGGGAGGGCGGGGCGAA
(Product: 457)
Promoter function confirmation
G1 promoter function confirmation by transient transfection using 293T cells. Photos taken 48 hours after transient transfection, 10x. pCDK4, pKi67 and pCCNE are our G1 promoters. pmPGK is the constitutive promoter of mouse PGK, it is a medium promoter, here used as a control.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 522
Illegal NheI site found at 526 - 21INCOMPATIBLE WITH RFC[21]Illegal XhoI site found at 531
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal AgeI site found at 142
Illegal AgeI site found at 173 - 1000COMPATIBLE WITH RFC[1000]