Difference between revisions of "Part:BBa K1926001"

Revision as of 03:20, 11 October 2016

A cyclic promoter of Cyclin E from human genome

This part is a cyclic promoter of protein Cyclin E from human genome. It can lead to transcription of the downstream DNA sequence once in every G1 phase[1,2]

1. Hwang, H.C. and B.E. Clurman, Cyclin E in normal and neoplastic cell cycles. Oncogene, 2005. 24(17): p. 2776-86.

2. Ohtani, K., J. DeGregori, and J.R. Nevins, Regulation of the cyclin E gene by transcription factor E2F1. Proc Natl Acad Sci U S A, 1995. 92(26): p. 12146-50.

You may use this part to:

1) Express something in mammal cell lines particularly in G1 phases or once in every cell cycle by stable transfecting it into cell line;

2) Use it as a human promoter by transient transfecting it into cells.

Source:

The sequence was retrieved from Addgene. We got it from human genome through PCR using the following primers:

pCCNE-F: CGTGTTTACATTCCACCCGCGCCA

pCCNE-R: TGATGGGGCTGCTCCGGCCT

(Product: 986)

Sequence and Features