Difference between revisions of "Part:BBa K1926001:Design"
(→Design Notes) |
(→References) |
||
Line 20: | Line 20: | ||
===References=== | ===References=== | ||
+ | 1. Hwang, H.C. and B.E. Clurman, Cyclin E in normal and neoplastic cell cycles. Oncogene, 2005. 24(17): p. 2776-86. | ||
+ | |||
+ | 2. Ohtani, K., J. DeGregori, and J.R. Nevins, Regulation of the cyclin E gene by transcription factor E2F1. Proc Natl Acad Sci U S A, 1995. 92(26): p. 12146-50. |
Revision as of 02:57, 11 October 2016
A cyclic promoter of Cyclin E from human genome
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NotI site found at 382
Illegal NotI site found at 497 - 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 529
Illegal XhoI site found at 1050 - 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 273
Illegal NgoMIV site found at 313
Illegal NgoMIV site found at 491 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
We got this sequence from human genome through PCR using the following primers:
pCCNE-F: CGTGTTTACATTCCACCCGCGCCA
pCCNE-R: TGATGGGGCTGCTCCGGCCT
(Product: 986)
Source
The sequence was retrieved from Addgene.
References
1. Hwang, H.C. and B.E. Clurman, Cyclin E in normal and neoplastic cell cycles. Oncogene, 2005. 24(17): p. 2776-86.
2. Ohtani, K., J. DeGregori, and J.R. Nevins, Regulation of the cyclin E gene by transcription factor E2F1. Proc Natl Acad Sci U S A, 1995. 92(26): p. 12146-50.