Difference between revisions of "Help:BioBrick Prefix and Suffix"
Smelissali (Talk | contribs) |
Smelissali (Talk | contribs) (→BioBrick Prefix) |
||
| Line 57: | Line 57: | ||
===BioBrick Prefix=== | ===BioBrick Prefix=== | ||
| − | The standard BioBrick prefix depends on the part that follows it (<FONT COLOR="#BABABA"> | + | The standard BioBrick prefix depends on the part that follows it (<FONT COLOR="#BABABA">YOUR CONNECTING PART IN GREY</FONT>, <FONT COLOR="#CC00FF">EcoRI</FONT>,<FONT COLOR="#FF5333"> XbaI</FONT>, '''rest of the BioBrick sequence'''). YOUR SEQUENCE as it should be entered into the database is in uppercase letters. |
{|width='85%' style='border:1px solid gray; margin-left:2em' | {|width='85%' style='border:1px solid gray; margin-left:2em' | ||
|width='45%'| | |width='45%'| | ||
Revision as of 01:35, 5 June 2007
Contents
Basic Information
|
|
For more information about how the prefix and suffix were determined and the special case of coding regions, see Assembly:RBS-CDS_issues. |
Part Sequence
The DNA sequence for parts in the Registry starts with the first base of the part itself and ends with its last base. For example, a protein coding sequence is like this "ATG----------TAATAA". The sequence in the Registry does not include any bases of the BioBrick Prefix or Suffix.
Plasmids (see below) and primers or tags that explicitly specify prefix or suffix bases are exceptions to this rule.
BioBrick Prefix
The standard BioBrick prefix depends on the part that follows it.
|
If the following part is a coding sequence or any other part that starts "ATG", the BioBrick prefix is: |
gaattcgcggccgcttctag
|
|
Otherwise, the BioBrick prefix is: |
gaattcgcggccgcttctagag
|
BioBrick Suffix
|
The standard BioBrick suffix is always: |
tactagtagcggccgctgcag
|
BioBrick Scar
When BioBricks with these prefix and suffix sequencees are assembled, there is a "scar" between these parts.
|
If the second part starts "AT", the scar is: |
tactag
|
|
Otherwise, the scar is: |
tactagag
|
Additional information on Prefix and Suffix
BioBrick Prefix
The standard BioBrick prefix depends on the part that follows it (YOUR CONNECTING PART IN GREY, EcoRI, XbaI, rest of the BioBrick sequence). YOUR SEQUENCE as it should be entered into the database is in uppercase letters.
|
If the following part is a coding sequence or any other part that starts "ATG", the BioBrick prefix is: |
gaattcgcggccgcttctagATG... |
|
Otherwise, the BioBrick prefix is: |
gaattcgcggccgcttctagagCA... |
BioBrick Suffix
Similarly, the standard BioBrick prefix depends on the part that preceeds it. Whenever possible, the transcriptional start site of a promoter part should lie 2bp upstream of the SpeI site. (part in grey, PstI, SpeI). YOUR SEQUENCE as it should be entered into the database is in uppercase letters. For help locating the transcription initiation site in your promoter part, try [http://www.fruitfly.org/seq_tools/promoter.html promoter prediction.]
|
The standard BioBrick suffix for most parts: |
...ACtactagtagcggccgctgcag |
|
For promoter parts, the transcriptional initiation site (in green) is placed 2 bp upstream of the SpeI site: |
...CACtactagtagcggccgctgcag |