Difference between revisions of "Part:BBa K1680015:Design"

 
Line 1: Line 1:
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K1680015 short</partinfo>
 
<partinfo>BBa_K1680015 short</partinfo>
Line 7: Line 6:
  
 
===Design Notes===
 
===Design Notes===
contains an RFC10 compatible multiple cloning site, no restrictions sites for RFC10 in the Backbone. ADH Terminator after MCS.
 
  
 +
This part is derived from the pRS315 vector (Sikorski 1989). It is mutagenised to be compatible with RFC10 and the wild type MCS was switched for a RFC10 MCS. The biobrick MCS is flanked by ''Apa''I (Prefix) and ''Sac''I (Suffix) restriction sites. These can be used together with either ''Eco''RI or ''Pst''I site to introduce a promoter or terminator stably into the vector without disturbing the RFC10 standard.
  
 +
 +
Sequence of the new RFC10 MCS:
 +
 +
GGGCCCACGTGAATTCGCGGCCGCTTCTAGAGTACTAGTAGCGGCCGCTGCAGACGTGAGCTC
  
 
===Source===
 
===Source===
  
yeast shuttle vector
+
Derived from pRS315 (Sikorski 1989).
 +
 
  
 
===References===
 
===References===
 +
 +
Sikorski, Robert S., and Philip Hieter. "A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae." Genetics 122.1 (1989): 19-27.

Revision as of 01:02, 26 September 2015

pRS315 yeast shuttle vector with Biobrick MCS


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 3171
    Illegal XbaI site found at 3156
    Illegal SpeI site found at 3148
    Illegal PstI site found at 3134
  • 12
    INCOMPATIBLE WITH RFC[12]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 3171
    Illegal SpeI site found at 3148
    Illegal PstI site found at 3134
    Illegal NotI site found at 3139
    Illegal NotI site found at 3163
  • 21
    INCOMPATIBLE WITH RFC[21]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 3171
    Illegal XhoI site found at 2410
  • 23
    INCOMPATIBLE WITH RFC[23]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 3171
    Illegal XbaI site found at 3156
    Illegal SpeI site found at 3148
    Illegal PstI site found at 3134
  • 25
    INCOMPATIBLE WITH RFC[25]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 3171
    Illegal XbaI site found at 3156
    Illegal SpeI site found at 3148
    Illegal PstI site found at 3134
    Illegal NgoMIV site found at 2799
    Illegal AgeI site found at 1503
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal BsaI.rc site found at 4545
    Illegal SapI site found at 3462
    Illegal SapI site found at 5566


Design Notes

This part is derived from the pRS315 vector (Sikorski 1989). It is mutagenised to be compatible with RFC10 and the wild type MCS was switched for a RFC10 MCS. The biobrick MCS is flanked by ApaI (Prefix) and SacI (Suffix) restriction sites. These can be used together with either EcoRI or PstI site to introduce a promoter or terminator stably into the vector without disturbing the RFC10 standard.


Sequence of the new RFC10 MCS:

GGGCCCACGTGAATTCGCGGCCGCTTCTAGAGTACTAGTAGCGGCCGCTGCAGACGTGAGCTC

Source

Derived from pRS315 (Sikorski 1989).


References

Sikorski, Robert S., and Philip Hieter. "A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae." Genetics 122.1 (1989): 19-27.