Difference between revisions of "Part:BBa B0040:Design"
(→Design Notes) |
(→Design Notes) |
||
| Line 30: | Line 30: | ||
Also, note that the above changes further reduce (the already very weak) homology to current NCBI-stored sequences. | Also, note that the above changes further reduce (the already very weak) homology to current NCBI-stored sequences. | ||
| − | In the process of selecting the best sequence it appeared that a good alternative sequence for a spacer would be: AGGTTCTGATATGTAACTGTGCCCAATGTCGTTAGTGACGCATACCTCTTAAGAGGCCACTGTCCTAACA. The sequence contains no putative promoters and shows moderate homology with the 5' end of the Ampicillin resistance gene. However a strong promoter sequence starts 12 bp downstream of this sequence, and therefore the sequence presented above was preferred. | + | In the process of selecting the best sequence it appeared that a good alternative sequence for a spacer would be: AGGTTCTGATATGTAACTGTGCCCAATGTCGTTAGTGACGCATACCTCTTAAGAGGCCACTGTCCTAACA. The sequence contains no putative promoters and shows moderate homology with the 5' end of the Ampicillin resistance gene. However, a strong promoter sequence starts 12 bp downstream of this sequence, and therefore the sequence presented above was preferred. |
The sequence is compatible (does not show significant homology) with the components in the Elowitz repressilator plasmid. | The sequence is compatible (does not show significant homology) with the components in the Elowitz repressilator plasmid. | ||
Revision as of 19:09, 12 April 2007
Spacer.1 (generic)
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
The size of the spacer was chosen to meet the minimum length of a sequence that can be queried using the BLAST search engine. However, subsequences of it can be used to design shorter spacers. The sequence was selected from many more sequences randomly generated using the <a href="http://www.lifesci.ucsb.edu/~maduro/random.htm"> Random DNA Generator </a> engine; the GC% parameter used as input was 50%. The sequences were selected based on the following constraints listed in their order of importance: the absence of any putative promoter regions, a low degree of homology with the Elowitz plasmid (whose components are widely used in our designs), no homology with other E.coli sequences as shown by BLASTN search results and the presence of a number of TAA stop codons. The second constraint was the most stringent leading to the elimination of most sequences.
DE made the following changes to the original sequence in order to add stop codons in the -3 frame and more in the +2 frame (note, not all of these stop codons are UAA. Thus, if used in an organism that inserts an amino acid @ UGA or UAG the obvious will occur):
T->A @ 85
T->A @ 42
C->T @ 79
A->T @ 64
A->T @ 31
T->A @ 34
C->A @ 37
Also, note that the above changes further reduce (the already very weak) homology to current NCBI-stored sequences.
In the process of selecting the best sequence it appeared that a good alternative sequence for a spacer would be: AGGTTCTGATATGTAACTGTGCCCAATGTCGTTAGTGACGCATACCTCTTAAGAGGCCACTGTCCTAACA. The sequence contains no putative promoters and shows moderate homology with the 5' end of the Ampicillin resistance gene. However, a strong promoter sequence starts 12 bp downstream of this sequence, and therefore the sequence presented above was preferred.
The sequence is compatible (does not show significant homology) with the components in the Elowitz repressilator plasmid.
Source
Randomly generated and optimized for several parameters (see Design notes).