Difference between revisions of "Part:BBa K1777000"
(→‎As a tool)
 
(3 intermediate revisions by the same user not shown)
Line 18: Line 18:
 
===Construct===
 
===Construct===
 
microRNA-21 is overexpressed in several glioblastoma cell lines and Hela cells compared with 293T cells, which expresses low level of mir-21.Using the unique restriction sites(Xho I and Pme I), the mir-21 binding site is cloned into the multiple cloning region located 3 ́ to the synthetic Renilla luciferase gene and its translational stop codon. After cloning, the vector can be transfected into the mammalian cell line, and a fusion of the Renilla luciferase gene and the gene of interest is transcribed. Oure RNA sponde can be cotransfected simultaneously. If the sponge binds to the target miRNA and initiates the knock down, the fused Renilla luciferase:gene of interest mRNA will be cleaved and subsequently degraded, decreasing the Renilla luciferase signal.<br>
 
microRNA-21 is overexpressed in several glioblastoma cell lines and Hela cells compared with 293T cells, which expresses low level of mir-21.Using the unique restriction sites(Xho I and Pme I), the mir-21 binding site is cloned into the multiple cloning region located 3 ́ to the synthetic Renilla luciferase gene and its translational stop codon. After cloning, the vector can be transfected into the mammalian cell line, and a fusion of the Renilla luciferase gene and the gene of interest is transcribed. Oure RNA sponde can be cotransfected simultaneously. If the sponge binds to the target miRNA and initiates the knock down, the fused Renilla luciferase:gene of interest mRNA will be cleaved and subsequently degraded, decreasing the Renilla luciferase signal.<br>
−
[[File:miR21 model.jpg]]<br>
+
[[File:miR21 model.jpg| 700 px]]<br>
−
'''Figure 3.two miR21 binding sites with luciferase construct.'''<br>
+
'''Figure 1.two miR21 binding sites with luciferase construct.'''<br>
 
T7:T7 RNA polumerase promoter,  HSV-TK: HSV-TK promoter, ''hRluc'':Synthetic ''Renilla'' luciferase gene with 3'UTR,  ''hluc+'': Synthetic firefly luciferase gene, MBS: multiple binding site
 
T7:T7 RNA polumerase promoter,  HSV-TK: HSV-TK promoter, ''hRluc'':Synthetic ''Renilla'' luciferase gene with 3'UTR,  ''hluc+'': Synthetic firefly luciferase gene, MBS: multiple binding site
 +
 
===Function===
 
===Function===
 
Two miR-21 binding sites can bind miR-21 so that the Renilla Luciferase is reduced in miR21 overexpressed cells (Hela, U87 cell lines) compared with the normal cell line(HEK 293T)<br>
 
Two miR-21 binding sites can bind miR-21 so that the Renilla Luciferase is reduced in miR21 overexpressed cells (Hela, U87 cell lines) compared with the normal cell line(HEK 293T)<br>
Line 27: Line 28:
 
HEK-293T cells, Hela cells and U87 cells were seeded into a 24-well plate. MiR21 binding sites was subcloned into the psiCHECKTM-2 Vector using the XhoI and PmeI restriction sites. Twenty hours post- transfection, Renilla and Firefly luciferase activities were measured using the Dual- Luciferase® Reporter 1000 Assay System (Cat.# E1980; 21). The Renilla luciferase data has been normalized to firefly luciferase data, each experiment has three or five replicates. The data indicate in miR21 overexpressed cells (Hela and U87), miR21 binding sites are binded with miR21, inhibiting the Renilla luciferase while in control cells (HEK 293T), the Renilla luciferase is at normal level.
 
HEK-293T cells, Hela cells and U87 cells were seeded into a 24-well plate. MiR21 binding sites was subcloned into the psiCHECKTM-2 Vector using the XhoI and PmeI restriction sites. Twenty hours post- transfection, Renilla and Firefly luciferase activities were measured using the Dual- Luciferase® Reporter 1000 Assay System (Cat.# E1980; 21). The Renilla luciferase data has been normalized to firefly luciferase data, each experiment has three or five replicates. The data indicate in miR21 overexpressed cells (Hela and U87), miR21 binding sites are binded with miR21, inhibiting the Renilla luciferase while in control cells (HEK 293T), the Renilla luciferase is at normal level.
 
===As a tool===
 
===As a tool===
−
Since the binding sites can bind miR21 significantly, we use it as a tool to detect whether our sponge can knock down the level of miR21 in vivo. we cotransfected pSICHECK2-miR21 binding plasmid and pCDH-linear mir21 sponge(see [http://https://parts.igem.org/Part:BBa_K1777003])in Hela cells. Forty-eight hours post-transfection,Renilla and Firefly luciferase activities were measured using the Dual- Luciferase® Reporter 1000 Assay System. It proves that our pCDH-linear mir21 sponge knocks down the level of miR21.<br>
+
Since the binding sites can bind miR21 significantly, we use it as a tool to detect whether our sponge can knock down the level of miR21 in vivo. we cotransfected pSICHECK2-miR21 binding plasmid and pCDH-linear mir21 sponge(see BBa_K1777003 [http://https://parts.igem.org/Part:BBa_K1777003])in Hela cells. Forty-eight hours post-transfection,Renilla and Firefly luciferase activities were measured using the Dual- Luciferase® Reporter 1000 Assay System. It proves that our pCDH-linear mir21 sponge knocks down the level of miR21.<br>
 
[[File:cotransfection hela.jpg]]<br>
 
[[File:cotransfection hela.jpg]]<br>
 
'''Figure 3. pCDH-linear-miR21-sponge binds miR21 using pSICHECK2-miR21 binding plasmid.''' <br>
 
'''Figure 3. pCDH-linear-miR21-sponge binds miR21 using pSICHECK2-miR21 binding plasmid.''' <br>
 
Hela cells were seeded into a 24-well plate. The cells are cotransfected with pSICHECK2-miR21 binding and pCDH-linear-miR21-sponge, pCDH vector as the negative control, each experiment has four replicates. Forty-eight hours post- transfection, Renilla and Firefly luciferase activities were measured using the Dual- Luciferase® Reporter 1000 Assay System (Cat.# E1980; 21). The Renilla luciferase data has been normalized to firefly luciferase data. The data indicate in Hela cell, miR21 is binded with pCDH-linear-miR21-sponge, the free miR21 is knocked down, increasing the Renilla luciferase while in control experiment, the Renilla luciferase has no obvious difference compared with pSICHECK2-miR21 binding.
 
Hela cells were seeded into a 24-well plate. The cells are cotransfected with pSICHECK2-miR21 binding and pCDH-linear-miR21-sponge, pCDH vector as the negative control, each experiment has four replicates. Forty-eight hours post- transfection, Renilla and Firefly luciferase activities were measured using the Dual- Luciferase® Reporter 1000 Assay System (Cat.# E1980; 21). The Renilla luciferase data has been normalized to firefly luciferase data. The data indicate in Hela cell, miR21 is binded with pCDH-linear-miR21-sponge, the free miR21 is knocked down, increasing the Renilla luciferase while in control experiment, the Renilla luciferase has no obvious difference compared with pSICHECK2-miR21 binding.
 +
 +
===References===
 +
siCHECKTM Vectors INSTRUCTIONS FOR USE OF PRODUCTS C8011 AND C8021.(Promega)<br>
 +
Dual-Luciferase® Reporter Assay System Instructions for use of Products E1910 and E1960.(Progema)
 +
Jennifer A. Chan,1,3 Anna M. Krichevsky,2 and Kenneth S. Kosik4,et al.MicroRNA-21 Is an Antiapoptotic Factor in Human Glioblastoma Cells.Cancer Res 2005; 65: (14). July 15, 200
 +
Eric C. Lai1.Micro RNAs are complementary to 3' UTR sequence motifs that mediate negative post-transcriptional regulation.Nature Genetics 30, 363 - 364 (2002) Published online: 18 March 2002 | doi:10.1038/ng865

Latest revision as of 13:23, 20 September 2015

two mir-21 binding sites

This part is composite of two mir-21 binding sites in the 3'-UTR. With this modification in the 3'-UTR, this luciferase can be inserted into 3'UTR and make the luciferase to serve as a reporter of mir-21. If this part is expressed in a cell with high level expression of mir-21, it will report a decreased Renilla luciferase activity.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]

TCGAGTCAACATCAGGACATAAGCTAGTTTTACTAGAGTCGAGTCAACATCAGGACATAAGCTAGTTT

Construct

microRNA-21 is overexpressed in several glioblastoma cell lines and Hela cells compared with 293T cells, which expresses low level of mir-21.Using the unique restriction sites(Xho I and Pme I), the mir-21 binding site is cloned into the multiple cloning region located 3 ́ to the synthetic Renilla luciferase gene and its translational stop codon. After cloning, the vector can be transfected into the mammalian cell line, and a fusion of the Renilla luciferase gene and the gene of interest is transcribed. Oure RNA sponde can be cotransfected simultaneously. If the sponge binds to the target miRNA and initiates the knock down, the fused Renilla luciferase:gene of interest mRNA will be cleaved and subsequently degraded, decreasing the Renilla luciferase signal.
MiR21 model.jpg
Figure 1.two miR21 binding sites with luciferase construct.
T7:T7 RNA polumerase promoter, HSV-TK: HSV-TK promoter, hRluc:Synthetic Renilla luciferase gene with 3'UTR, hluc+: Synthetic firefly luciferase gene, MBS: multiple binding site

Function

Two miR-21 binding sites can bind miR-21 so that the Renilla Luciferase is reduced in miR21 overexpressed cells (Hela, U87 cell lines) compared with the normal cell line(HEK 293T)
Mir21-3 cell.jpg
Figure 2. Validation of the psiCHECKTM2-miR21 binding plasmid.
HEK-293T cells, Hela cells and U87 cells were seeded into a 24-well plate. MiR21 binding sites was subcloned into the psiCHECKTM-2 Vector using the XhoI and PmeI restriction sites. Twenty hours post- transfection, Renilla and Firefly luciferase activities were measured using the Dual- Luciferase® Reporter 1000 Assay System (Cat.# E1980; 21). The Renilla luciferase data has been normalized to firefly luciferase data, each experiment has three or five replicates. The data indicate in miR21 overexpressed cells (Hela and U87), miR21 binding sites are binded with miR21, inhibiting the Renilla luciferase while in control cells (HEK 293T), the Renilla luciferase is at normal level.

As a tool

Since the binding sites can bind miR21 significantly, we use it as a tool to detect whether our sponge can knock down the level of miR21 in vivo. we cotransfected pSICHECK2-miR21 binding plasmid and pCDH-linear mir21 sponge(see BBa_K1777003 [http://https://parts.igem.org/Part:BBa_K1777003])in Hela cells. Forty-eight hours post-transfection,Renilla and Firefly luciferase activities were measured using the Dual- Luciferase® Reporter 1000 Assay System. It proves that our pCDH-linear mir21 sponge knocks down the level of miR21.
Cotransfection hela.jpg
Figure 3. pCDH-linear-miR21-sponge binds miR21 using pSICHECK2-miR21 binding plasmid.
Hela cells were seeded into a 24-well plate. The cells are cotransfected with pSICHECK2-miR21 binding and pCDH-linear-miR21-sponge, pCDH vector as the negative control, each experiment has four replicates. Forty-eight hours post- transfection, Renilla and Firefly luciferase activities were measured using the Dual- Luciferase® Reporter 1000 Assay System (Cat.# E1980; 21). The Renilla luciferase data has been normalized to firefly luciferase data. The data indicate in Hela cell, miR21 is binded with pCDH-linear-miR21-sponge, the free miR21 is knocked down, increasing the Renilla luciferase while in control experiment, the Renilla luciferase has no obvious difference compared with pSICHECK2-miR21 binding.

References

siCHECKTM Vectors INSTRUCTIONS FOR USE OF PRODUCTS C8011 AND C8021.(Promega)
Dual-Luciferase® Reporter Assay System Instructions for use of Products E1910 and E1960.(Progema) Jennifer A. Chan,1,3 Anna M. Krichevsky,2 and Kenneth S. Kosik4,et al.MicroRNA-21 Is an Antiapoptotic Factor in Human Glioblastoma Cells.Cancer Res 2005; 65: (14). July 15, 200 Eric C. Lai1.Micro RNAs are complementary to 3' UTR sequence motifs that mediate negative post-transcriptional regulation.Nature Genetics 30, 363 - 364 (2002) Published online: 18 March 2002 | doi:10.1038/ng865