Difference between revisions of "Part:BBa J31006:Design"
(→Design Notes) |
m (→Design Notes) |
||
(One intermediate revision by the same user not shown) | |||
Line 7: | Line 7: | ||
===Design Notes=== | ===Design Notes=== | ||
− | This part was PCR amplified from <partinfo>pSB1AT3</partinfo> using the following primers. The primers have non-annealing 5'- extensions that introduce a <font color='blue'>SpeI site</font> to the left and an <font color='red'>XbaI site</font> to the right of the coding region (allowing BioBrick cloning in the reverse orientation). Primer annealing sites are shown in bold. | + | This part was PCR-amplified from <partinfo>pSB1AT3</partinfo> using the following primers. The primers have non-annealing 5'- extensions that introduce a <font color='blue'>SpeI site</font> to the left and an <font color='red'>XbaI site</font> to the right of the coding region (allowing BioBrick cloning in the reverse orientation). Primer annealing sites are shown in bold. |
<br>Forward: 5’ ATGC<font color='blue'>ACTAGT</font><b>ATGAAATCTAACAATGCGCTCATC</b> | <br>Forward: 5’ ATGC<font color='blue'>ACTAGT</font><b>ATGAAATCTAACAATGCGCTCATC</b> | ||
<br>Reverse: 5’ GCAT<font color='red'>TCTAGA</font><b>TTAGGTCGAGGTGGCCCGGC</b> | <br>Reverse: 5’ GCAT<font color='red'>TCTAGA</font><b>TTAGGTCGAGGTGGCCCGGC</b> | ||
− | The final part was cloned into vector pSB1A2. The | + | The final part was cloned into vector pSB1A2. The BioBricks on this part are not wild-type, but the cut sites are still viable. |
{| width="800px" cellspacing="5" | {| width="800px" cellspacing="5" |
Latest revision as of 19:57, 11 April 2007
tetracycline resistance protein TetA(C) (backwards) [cf. BBa_J31007]
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 1043
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 897
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 343
Illegal NgoMIV site found at 503
Illegal NgoMIV site found at 871 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
This part was PCR-amplified from pSB1AT3 using the following primers. The primers have non-annealing 5'- extensions that introduce a SpeI site to the left and an XbaI site to the right of the coding region (allowing BioBrick cloning in the reverse orientation). Primer annealing sites are shown in bold.
Forward: 5’ ATGCACTAGTATGAAATCTAACAATGCGCTCATC
Reverse: 5’ GCATTCTAGATTAGGTCGAGGTGGCCCGGC
The final part was cloned into vector pSB1A2. The BioBricks on this part are not wild-type, but the cut sites are still viable.
Standard BioBrick Cloning Sites (Knight) | 5'--GAATTC GCGGCCGC T TCTAGA G ----insert---- T ACTAGT A GCGGCCG CTGCAG-- 3'--CTTAAG CGCCGGCG A AGATCT C -------------- A TGATCA T CGCCGGC GACGTC-- |
BBa_J31001 Cloning Sites | 5'--GAATTC GCGGCCGC T TCTAGA * --Tet coding-- * ACTAGT A GCGGCCG CTGCAG-- 3'--CTTAAG CGCCGGCG A AGATCT * -------------- * TGATCA T CGCCGGC GACGTC-- Prefix |
Data
Once placed to the right of a reverse RBS, TetB conveys tetrcycline resistance to JM109 cells (see BBa_S03532).
Source
The tetracycline resistance coding region was PCR amplified from pSB1AT3.